Incidental Mutation 'R7856:Tlx1'
ID607256
Institutional Source Beutler Lab
Gene Symbol Tlx1
Ensembl Gene ENSMUSG00000025215
Gene NameT cell leukemia, homeobox 1
SynonymsHox11, Hox-11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45150680-45156943 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 45155988 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 292 (Q292*)
Ref Sequence ENSEMBL: ENSMUSP00000026236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026236] [ENSMUST00000174617]
Predicted Effect probably null
Transcript: ENSMUST00000026236
AA Change: Q292*
SMART Domains Protein: ENSMUSP00000026236
Gene: ENSMUSG00000025215
AA Change: Q292*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 52 92 N/A INTRINSIC
low complexity region 107 133 N/A INTRINSIC
HOX 204 266 1.81e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174617
AA Change: Q50*
SMART Domains Protein: ENSMUSP00000133627
Gene: ENSMUSG00000025215
AA Change: Q50*

DomainStartEndE-ValueType
Pfam:Homeobox 1 19 6.3e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transcription factor that belongs to the NK-linked or NK-like (NKL) subfamily of homeobox genes. The encoded protein is required for normal development of the spleen during embryogenesis. This protein is also involved in specification of neuronal cell fates. Ectopic expression of this gene due to chromosomal translocations is associated with certain T-cell acute lymphoblastic leukemias. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutant embryos show cellular disorganization at the site of splenic development and never develop a spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Tlx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
vent UTSW 19 45156021 missense probably damaging 1.00
R1703:Tlx1 UTSW 19 45156004 missense possibly damaging 0.95
R4889:Tlx1 UTSW 19 45150979 missense probably damaging 1.00
R4985:Tlx1 UTSW 19 45150982 missense possibly damaging 0.94
R5078:Tlx1 UTSW 19 45156021 missense probably damaging 1.00
R6025:Tlx1 UTSW 19 45155974 missense probably damaging 0.99
R6396:Tlx1 UTSW 19 45156052 missense probably damaging 0.99
R6891:Tlx1 UTSW 19 45151318 missense probably damaging 1.00
R7163:Tlx1 UTSW 19 45151216 missense probably damaging 0.99
R7939:Tlx1 UTSW 19 45155988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAATGGGGCCATAAAGAGCTG -3'
(R):5'- TCCTGCGTGCAGTCAGAAAG -3'

Sequencing Primer
(F):5'- CTGTCTCCTGGGAGCTTGC -3'
(R):5'- CGTGCAGTCAGAAAGGGTGTC -3'
Posted On2019-12-20