Incidental Mutation 'R7857:Fbxo21'
ID607274
Institutional Source Beutler Lab
Gene Symbol Fbxo21
Ensembl Gene ENSMUSG00000032898
Gene NameF-box protein 21
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7857 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117976730-118010201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117988813 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 210 (S210P)
Ref Sequence ENSEMBL: ENSMUSP00000143873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035579] [ENSMUST00000202447]
Predicted Effect probably benign
Transcript: ENSMUST00000035579
AA Change: S210P

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035506
Gene: ENSMUSG00000032898
AA Change: S210P

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000202447
AA Change: S210P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143873
Gene: ENSMUSG00000032898
AA Change: S210P

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Arhgef40 T A 14: 51,988,755 H85Q probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cdon A G 9: 35,456,612 R268G possibly damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Dsg1b A T 18: 20,396,463 M322L probably benign Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wbp2nl A G 15: 82,306,072 N67S probably benign Het
Wdr35 T C 12: 9,008,113 probably null Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Zfp934 G A 13: 62,517,547 H459Y Het
Other mutations in Fbxo21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Fbxo21 APN 5 117988790 missense probably benign 0.04
IGL02131:Fbxo21 APN 5 118002090 missense possibly damaging 0.76
IGL02156:Fbxo21 APN 5 117994668 splice site probably benign
IGL02195:Fbxo21 APN 5 118002154 missense probably damaging 1.00
IGL02702:Fbxo21 APN 5 118000510 missense probably damaging 1.00
PIT1430001:Fbxo21 UTSW 5 117977866 missense possibly damaging 0.68
R0008:Fbxo21 UTSW 5 118008013 missense possibly damaging 0.63
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0089:Fbxo21 UTSW 5 118008143 missense probably benign
R0101:Fbxo21 UTSW 5 117995456 missense probably damaging 1.00
R0815:Fbxo21 UTSW 5 117995508 splice site probably benign
R0866:Fbxo21 UTSW 5 117977033 missense probably benign 0.01
R1673:Fbxo21 UTSW 5 118008064 missense probably benign 0.27
R2048:Fbxo21 UTSW 5 118008104 missense probably damaging 1.00
R2063:Fbxo21 UTSW 5 117976966 missense probably benign 0.45
R2161:Fbxo21 UTSW 5 117995386 missense probably damaging 1.00
R2224:Fbxo21 UTSW 5 118008123 missense probably damaging 1.00
R3872:Fbxo21 UTSW 5 118000329 missense possibly damaging 0.70
R4750:Fbxo21 UTSW 5 118000468 missense probably benign 0.10
R5807:Fbxo21 UTSW 5 117976868 missense probably benign 0.01
R6075:Fbxo21 UTSW 5 117988883 missense probably damaging 0.97
R6528:Fbxo21 UTSW 5 118000356 missense probably benign 0.25
R7494:Fbxo21 UTSW 5 118000323 missense possibly damaging 0.86
R7498:Fbxo21 UTSW 5 118002174 critical splice donor site probably null
R7801:Fbxo21 UTSW 5 117986124 missense probably damaging 0.96
R7940:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R8116:Fbxo21 UTSW 5 117990854 missense possibly damaging 0.70
Z1177:Fbxo21 UTSW 5 117989171 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCACCGTGTTGGCATGATG -3'
(R):5'- GACTGATAAGAGCCTGGCAG -3'

Sequencing Primer
(F):5'- GCCTAACATCCCCAGGAGCTG -3'
(R):5'- AGTGCTTCCCATCGTCAGGTAG -3'
Posted On2019-12-20