Incidental Mutation 'R7857:Cdon'
ID607285
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R7857 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35456612 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 268 (R268G)
Ref Sequence ENSEMBL: ENSMUSP00000045547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000137200] [ENSMUST00000151682] [ENSMUST00000154652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042842
AA Change: R268G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: R268G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119129
AA Change: R268G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: R268G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127264
SMART Domains Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 1 51 6.26e-5 SMART
IG_like 18 62 1.06e2 SMART
IGc2 81 134 6.45e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137200
Predicted Effect probably benign
Transcript: ENSMUST00000151682
SMART Domains Protein: ENSMUSP00000119206
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 40 103 1.35e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154652
AA Change: R268G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: R268G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Arhgef40 T A 14: 51,988,755 H85Q probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Dsg1b A T 18: 20,396,463 M322L probably benign Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Fbxo21 T C 5: 117,988,813 S210P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wbp2nl A G 15: 82,306,072 N67S probably benign Het
Wdr35 T C 12: 9,008,113 probably null Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Zfp934 G A 13: 62,517,547 H459Y Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGACACGAGTCATTTC -3'
(R):5'- ACCAGTTAGACTAGGAAAATGATGC -3'

Sequencing Primer
(F):5'- GTGGACACGAGTCATTTCTAATG -3'
(R):5'- TCACATCTCCGGACTTGT -3'
Posted On2019-12-20