Incidental Mutation 'R0194:Yeats2'
ID60729
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene NameYEATS domain containing 2
Synonyms
MMRRC Submission 038453-MU
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0194 (G1)
Quality Score106
Status Validated
Chromosome16
Chromosomal Location20141063-20232573 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 20152969 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000087506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000231705] [ENSMUST00000232019] [ENSMUST00000232338]
Predicted Effect probably null
Transcript: ENSMUST00000090052
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: M1T

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115560
AA Change: M54T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: M54T

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231705
AA Change: M54T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000232019
AA Change: M20T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably null
Transcript: ENSMUST00000232338
AA Change: M1T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.2547 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2076:Yeats2 UTSW 16 20186282 missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4811:Yeats2 UTSW 16 20152895 splice site probably null
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5328:Yeats2 UTSW 16 20171205 missense probably damaging 1.00
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6168:Yeats2 UTSW 16 20179558 missense probably benign 0.01
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6371:Yeats2 UTSW 16 20221710 missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
R8353:Yeats2 UTSW 16 20222887 nonsense probably null
R8367:Yeats2 UTSW 16 20222825 missense probably damaging 1.00
R8453:Yeats2 UTSW 16 20222887 nonsense probably null
R8506:Yeats2 UTSW 16 20152934 missense probably damaging 0.98
R8535:Yeats2 UTSW 16 20159176 missense probably damaging 1.00
R8828:Yeats2 UTSW 16 20150510 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACCTTTCTGTCTGTCTATCACACGGTAT -3'
(R):5'- tgcccatcCCTTAGCAGGATAATTtttt -3'

Sequencing Primer
(F):5'- TTGTGTGATGAACTCAAAGCAG -3'
(R):5'- gctgaaactcactgtaaagacc -3'
Posted On2013-07-24