Incidental Mutation 'R0194:Yeats2'
ID 60729
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene Name YEATS domain containing 2
Synonyms
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R0194 (G1)
Quality Score 106
Status Validated
Chromosome 16
Chromosomal Location 19959813-20051323 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to C at 19971719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000087506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000231705] [ENSMUST00000232019] [ENSMUST00000232338]
AlphaFold Q3TUF7
Predicted Effect probably null
Transcript: ENSMUST00000090052
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: M1T

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115560
AA Change: M54T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: M54T

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231705
AA Change: M54T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000232019
AA Change: M20T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably null
Transcript: ENSMUST00000232338
AA Change: M1T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.2547 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20,005,054 (GRCm39) missense probably damaging 0.99
IGL01128:Yeats2 APN 16 19,980,718 (GRCm39) splice site probably benign
IGL01139:Yeats2 APN 16 20,033,143 (GRCm39) missense probably damaging 1.00
IGL01394:Yeats2 APN 16 19,980,782 (GRCm39) missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20,041,671 (GRCm39) missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20,024,917 (GRCm39) missense probably damaging 1.00
IGL01925:Yeats2 APN 16 19,998,430 (GRCm39) splice site probably benign
IGL02106:Yeats2 APN 16 20,011,970 (GRCm39) missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 19,969,221 (GRCm39) missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20,012,429 (GRCm39) missense probably benign 0.00
IGL02669:Yeats2 APN 16 20,005,033 (GRCm39) missense probably benign 0.13
IGL03155:Yeats2 APN 16 20,048,323 (GRCm39) critical splice donor site probably null
tyrion UTSW 16 20,032,151 (GRCm39) splice site probably benign
P0045:Yeats2 UTSW 16 19,975,695 (GRCm39) missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20,012,474 (GRCm39) nonsense probably null
R0051:Yeats2 UTSW 16 20,012,474 (GRCm39) nonsense probably null
R0118:Yeats2 UTSW 16 19,975,692 (GRCm39) nonsense probably null
R0157:Yeats2 UTSW 16 20,040,427 (GRCm39) makesense probably null
R0184:Yeats2 UTSW 16 20,022,435 (GRCm39) missense possibly damaging 0.79
R0612:Yeats2 UTSW 16 20,005,175 (GRCm39) missense probably benign 0.00
R0655:Yeats2 UTSW 16 20,012,574 (GRCm39) nonsense probably null
R0826:Yeats2 UTSW 16 20,011,966 (GRCm39) nonsense probably null
R1526:Yeats2 UTSW 16 20,024,836 (GRCm39) missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20,008,115 (GRCm39) missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20,005,018 (GRCm39) nonsense probably null
R1842:Yeats2 UTSW 16 19,989,988 (GRCm39) missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20,048,314 (GRCm39) missense probably benign 0.01
R1926:Yeats2 UTSW 16 20,033,176 (GRCm39) missense probably benign
R2000:Yeats2 UTSW 16 20,005,141 (GRCm39) missense probably benign 0.20
R2017:Yeats2 UTSW 16 19,977,931 (GRCm39) missense probably benign 0.01
R2076:Yeats2 UTSW 16 20,005,032 (GRCm39) missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 19,972,916 (GRCm39) missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20,032,151 (GRCm39) splice site probably benign
R2981:Yeats2 UTSW 16 20,005,051 (GRCm39) missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20,012,395 (GRCm39) missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20,012,395 (GRCm39) missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20,012,395 (GRCm39) missense probably damaging 1.00
R3774:Yeats2 UTSW 16 19,969,245 (GRCm39) missense probably damaging 1.00
R4250:Yeats2 UTSW 16 19,975,685 (GRCm39) missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20,027,172 (GRCm39) missense probably damaging 1.00
R4455:Yeats2 UTSW 16 19,980,743 (GRCm39) missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20,032,071 (GRCm39) missense probably damaging 0.99
R4811:Yeats2 UTSW 16 19,971,645 (GRCm39) splice site probably null
R4902:Yeats2 UTSW 16 20,026,418 (GRCm39) missense probably benign 0.00
R5043:Yeats2 UTSW 16 20,027,215 (GRCm39) missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20,027,215 (GRCm39) missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20,005,175 (GRCm39) missense probably benign 0.01
R5328:Yeats2 UTSW 16 19,989,955 (GRCm39) missense probably damaging 1.00
R5360:Yeats2 UTSW 16 19,972,912 (GRCm39) missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20,030,319 (GRCm39) missense probably benign 0.01
R5672:Yeats2 UTSW 16 19,980,779 (GRCm39) missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20,012,553 (GRCm39) missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20,011,913 (GRCm39) missense probably benign 0.06
R5946:Yeats2 UTSW 16 20,026,513 (GRCm39) nonsense probably null
R6168:Yeats2 UTSW 16 19,998,308 (GRCm39) missense probably benign 0.01
R6169:Yeats2 UTSW 16 20,038,417 (GRCm39) missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20,033,225 (GRCm39) missense probably benign 0.16
R6371:Yeats2 UTSW 16 20,040,460 (GRCm39) missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 19,998,344 (GRCm39) missense probably benign 0.00
R7149:Yeats2 UTSW 16 19,972,939 (GRCm39) missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20,041,663 (GRCm39) missense probably damaging 1.00
R8353:Yeats2 UTSW 16 20,041,637 (GRCm39) nonsense probably null
R8367:Yeats2 UTSW 16 20,041,575 (GRCm39) missense probably damaging 1.00
R8453:Yeats2 UTSW 16 20,041,637 (GRCm39) nonsense probably null
R8506:Yeats2 UTSW 16 19,971,684 (GRCm39) missense probably damaging 0.98
R8535:Yeats2 UTSW 16 19,977,926 (GRCm39) missense probably damaging 1.00
R8828:Yeats2 UTSW 16 19,969,260 (GRCm39) missense probably benign 0.45
R8905:Yeats2 UTSW 16 20,009,144 (GRCm39) missense probably benign 0.02
R8924:Yeats2 UTSW 16 19,969,312 (GRCm39) critical splice donor site probably null
R9087:Yeats2 UTSW 16 20,030,500 (GRCm39) critical splice donor site probably null
R9276:Yeats2 UTSW 16 19,975,786 (GRCm39) missense probably benign 0.34
R9338:Yeats2 UTSW 16 20,041,533 (GRCm39) missense probably damaging 0.99
R9338:Yeats2 UTSW 16 20,032,078 (GRCm39) missense possibly damaging 0.69
R9378:Yeats2 UTSW 16 20,033,228 (GRCm39) missense probably benign
R9569:Yeats2 UTSW 16 19,972,902 (GRCm39) missense probably damaging 1.00
R9664:Yeats2 UTSW 16 20,047,491 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTTCTGTCTGTCTATCACACGGTAT -3'
(R):5'- tgcccatcCCTTAGCAGGATAATTtttt -3'

Sequencing Primer
(F):5'- TTGTGTGATGAACTCAAAGCAG -3'
(R):5'- gctgaaactcactgtaaagacc -3'
Posted On 2013-07-24