Incidental Mutation 'R7857:Wdr35'
ID607293
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7857 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 9008113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
Predicted Effect probably null
Transcript: ENSMUST00000085745
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111113
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Arhgef40 T A 14: 51,988,755 H85Q probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cdon A G 9: 35,456,612 R268G possibly damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Dsg1b A T 18: 20,396,463 M322L probably benign Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Fbxo21 T C 5: 117,988,813 S210P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wbp2nl A G 15: 82,306,072 N67S probably benign Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Zfp934 G A 13: 62,517,547 H459Y Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTTGCTAGGTCAGTATCACTCTG -3'
(R):5'- ATGTGACCCAAATCAGGTAGTATC -3'

Sequencing Primer
(F):5'- CACTCTGGTTTTAAGAACATGGGC -3'
(R):5'- CCCAAATCAGGTAGTATCAAGATATG -3'
Posted On2019-12-20