Incidental Mutation 'R0194:Cacna1h'
ID 60730
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Name calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms alpha13.2, T-type Cav3.2, Cav3.2
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 102
Status Validated
Chromosome 17
Chromosomal Location 25593259-25652757 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 25599898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078496
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159331
Predicted Effect probably benign
Transcript: ENSMUST00000159610
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161035
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25,600,482 (GRCm39) missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25,610,924 (GRCm39) missense probably benign 0.24
IGL01625:Cacna1h APN 17 25,604,686 (GRCm39) missense possibly damaging 0.95
IGL01625:Cacna1h APN 17 25,602,459 (GRCm39) missense probably damaging 0.97
IGL01684:Cacna1h APN 17 25,607,690 (GRCm39) missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25,602,457 (GRCm39) missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25,607,024 (GRCm39) missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25,616,585 (GRCm39) missense probably benign 0.10
IGL02190:Cacna1h APN 17 25,652,000 (GRCm39) missense probably benign
IGL02686:Cacna1h APN 17 25,604,723 (GRCm39) missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25,599,506 (GRCm39) missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25,607,033 (GRCm39) missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25,651,868 (GRCm39) nonsense probably null
IGL03095:Cacna1h APN 17 25,602,752 (GRCm39) unclassified probably benign
IGL03207:Cacna1h APN 17 25,610,307 (GRCm39) missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25,610,286 (GRCm39) missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25,610,118 (GRCm39) missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25,599,818 (GRCm39) missense probably damaging 1.00
R0361:Cacna1h UTSW 17 25,608,396 (GRCm39) missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25,607,641 (GRCm39) missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25,600,524 (GRCm39) missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25,606,538 (GRCm39) missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25,612,520 (GRCm39) missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25,607,602 (GRCm39) missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25,607,602 (GRCm39) missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25,597,749 (GRCm39) unclassified probably benign
R1351:Cacna1h UTSW 17 25,610,925 (GRCm39) missense probably benign 0.14
R1457:Cacna1h UTSW 17 25,616,594 (GRCm39) missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25,616,328 (GRCm39) missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25,596,835 (GRCm39) nonsense probably null
R1611:Cacna1h UTSW 17 25,600,445 (GRCm39) missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25,602,445 (GRCm39) missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25,611,050 (GRCm39) missense probably benign 0.01
R1858:Cacna1h UTSW 17 25,599,781 (GRCm39) missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25,595,861 (GRCm39) missense probably benign 0.01
R2039:Cacna1h UTSW 17 25,610,819 (GRCm39) missense probably benign 0.03
R2091:Cacna1h UTSW 17 25,651,850 (GRCm39) missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25,602,502 (GRCm39) missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25,599,234 (GRCm39) missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25,599,234 (GRCm39) missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25,603,987 (GRCm39) missense probably benign 0.10
R2207:Cacna1h UTSW 17 25,603,987 (GRCm39) missense probably benign 0.10
R2224:Cacna1h UTSW 17 25,604,917 (GRCm39) missense probably benign 0.03
R2226:Cacna1h UTSW 17 25,604,917 (GRCm39) missense probably benign 0.03
R2261:Cacna1h UTSW 17 25,652,139 (GRCm39) missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25,602,986 (GRCm39) missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25,614,426 (GRCm39) missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25,652,108 (GRCm39) missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25,611,427 (GRCm39) missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25,606,837 (GRCm39) missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25,599,601 (GRCm39) missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25,612,884 (GRCm39) missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25,596,261 (GRCm39) missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25,608,396 (GRCm39) missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25,616,782 (GRCm39) missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25,594,224 (GRCm39) missense probably benign 0.02
R5148:Cacna1h UTSW 17 25,606,519 (GRCm39) missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25,611,205 (GRCm39) missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25,602,160 (GRCm39) missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25,596,641 (GRCm39) missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25,606,023 (GRCm39) missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25,595,896 (GRCm39) missense probably benign 0.00
R5954:Cacna1h UTSW 17 25,602,175 (GRCm39) missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25,596,246 (GRCm39) missense probably benign 0.01
R6110:Cacna1h UTSW 17 25,610,250 (GRCm39) missense probably benign 0.10
R6125:Cacna1h UTSW 17 25,604,668 (GRCm39) missense probably benign 0.00
R6189:Cacna1h UTSW 17 25,616,818 (GRCm39) missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25,597,793 (GRCm39) missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25,616,630 (GRCm39) critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25,602,053 (GRCm39) missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25,606,455 (GRCm39) missense probably benign 0.32
R6695:Cacna1h UTSW 17 25,612,714 (GRCm39) missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25,600,524 (GRCm39) missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25,604,013 (GRCm39) missense probably benign
R6942:Cacna1h UTSW 17 25,604,013 (GRCm39) missense probably benign
R6955:Cacna1h UTSW 17 25,607,030 (GRCm39) missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25,612,977 (GRCm39) missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25,610,481 (GRCm39) missense probably benign 0.31
R7125:Cacna1h UTSW 17 25,602,510 (GRCm39) missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25,596,629 (GRCm39) missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25,603,739 (GRCm39) missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25,597,811 (GRCm39) missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25,608,435 (GRCm39) missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25,604,600 (GRCm39) missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25,611,083 (GRCm39) missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25,608,346 (GRCm39) missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25,604,779 (GRCm39) missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25,608,451 (GRCm39) missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25,594,225 (GRCm39) missense probably benign
R7898:Cacna1h UTSW 17 25,611,250 (GRCm39) missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25,594,865 (GRCm39) missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25,611,445 (GRCm39) nonsense probably null
R8139:Cacna1h UTSW 17 25,602,697 (GRCm39) missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25,596,204 (GRCm39) missense probably benign 0.00
R8795:Cacna1h UTSW 17 25,612,538 (GRCm39) missense probably damaging 1.00
R9227:Cacna1h UTSW 17 25,599,856 (GRCm39) missense probably damaging 1.00
R9230:Cacna1h UTSW 17 25,599,856 (GRCm39) missense probably damaging 1.00
R9236:Cacna1h UTSW 17 25,600,424 (GRCm39) missense probably damaging 1.00
R9360:Cacna1h UTSW 17 25,594,336 (GRCm39) missense probably benign 0.00
R9476:Cacna1h UTSW 17 25,611,524 (GRCm39) missense probably damaging 1.00
R9567:Cacna1h UTSW 17 25,612,487 (GRCm39) missense probably damaging 1.00
R9696:Cacna1h UTSW 17 25,602,215 (GRCm39) missense possibly damaging 0.90
V1662:Cacna1h UTSW 17 25,596,283 (GRCm39) missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25,610,224 (GRCm39) missense probably benign
Z1177:Cacna1h UTSW 17 25,612,558 (GRCm39) missense probably benign 0.15
Z1177:Cacna1h UTSW 17 25,610,352 (GRCm39) missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25,594,866 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCAATCTCCTCCAGCGCAATG -3'
(R):5'- ATCCTGAAGGACTTCCCTCTGCAC -3'

Sequencing Primer
(F):5'- AGCGCAATGCCCATGATG -3'
(R):5'- GAGTATACACTTGGCCTTTGGAAC -3'
Posted On 2013-07-24