Incidental Mutation 'R0194:Cacna1h'
ID 60730
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Name calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms Cav3.2, alpha13.2, T-type Cav3.2
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 102
Status Validated
Chromosome 17
Chromosomal Location 25374285-25433783 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 25380924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078496
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159331
Predicted Effect probably benign
Transcript: ENSMUST00000159610
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161035
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25381508 missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25391950 missense probably benign 0.24
IGL01625:Cacna1h APN 17 25383485 missense probably damaging 0.97
IGL01625:Cacna1h APN 17 25385712 missense possibly damaging 0.95
IGL01684:Cacna1h APN 17 25388716 missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25383483 missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25388050 missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25397611 missense probably benign 0.10
IGL02190:Cacna1h APN 17 25433026 missense probably benign
IGL02686:Cacna1h APN 17 25385749 missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25380532 missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25388059 missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25432894 nonsense probably null
IGL03095:Cacna1h APN 17 25383778 unclassified probably benign
IGL03207:Cacna1h APN 17 25391333 missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25391312 missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25391144 missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25380844 missense probably damaging 1.00
R0361:Cacna1h UTSW 17 25389422 missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25388667 missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25387564 missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25393546 missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25378775 unclassified probably benign
R1351:Cacna1h UTSW 17 25391951 missense probably benign 0.14
R1457:Cacna1h UTSW 17 25397620 missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25397354 missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25377861 nonsense probably null
R1611:Cacna1h UTSW 17 25381471 missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25383471 missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25392076 missense probably benign 0.01
R1858:Cacna1h UTSW 17 25380807 missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25376887 missense probably benign 0.01
R2039:Cacna1h UTSW 17 25391845 missense probably benign 0.03
R2091:Cacna1h UTSW 17 25432876 missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25383528 missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2207:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2224:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2226:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2261:Cacna1h UTSW 17 25433165 missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25384012 missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25395452 missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25433134 missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25392453 missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25387863 missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25380627 missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25393910 missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25377287 missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25389422 missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25397808 missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25375250 missense probably benign 0.02
R5148:Cacna1h UTSW 17 25387545 missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25392231 missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25383186 missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25377667 missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25387049 missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25376922 missense probably benign 0.00
R5954:Cacna1h UTSW 17 25383201 missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25377272 missense probably benign 0.01
R6110:Cacna1h UTSW 17 25391276 missense probably benign 0.10
R6125:Cacna1h UTSW 17 25385694 missense probably benign 0.00
R6189:Cacna1h UTSW 17 25397844 missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25378819 missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25397656 critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25383079 missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25387481 missense probably benign 0.32
R6695:Cacna1h UTSW 17 25393740 missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25385039 missense probably benign
R6942:Cacna1h UTSW 17 25385039 missense probably benign
R6955:Cacna1h UTSW 17 25388056 missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25394003 missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25391507 missense probably benign 0.31
R7125:Cacna1h UTSW 17 25383536 missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25377655 missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25384765 missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25378837 missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25389461 missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25385626 missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25392109 missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25389372 missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25385805 missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25389477 missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25375251 missense probably benign
R7898:Cacna1h UTSW 17 25392276 missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25375891 missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25392471 nonsense probably null
R8139:Cacna1h UTSW 17 25383723 missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25377230 missense probably benign 0.00
R8795:Cacna1h UTSW 17 25393564 missense probably damaging 1.00
R9227:Cacna1h UTSW 17 25380882 missense probably damaging 1.00
R9230:Cacna1h UTSW 17 25380882 missense probably damaging 1.00
R9236:Cacna1h UTSW 17 25381450 missense probably damaging 1.00
R9360:Cacna1h UTSW 17 25375362 missense probably benign 0.00
R9476:Cacna1h UTSW 17 25392550 missense probably damaging 1.00
R9567:Cacna1h UTSW 17 25393513 missense probably damaging 1.00
R9696:Cacna1h UTSW 17 25383241 missense possibly damaging 0.90
V1662:Cacna1h UTSW 17 25377309 missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25391250 missense probably benign
Z1177:Cacna1h UTSW 17 25375892 missense probably damaging 1.00
Z1177:Cacna1h UTSW 17 25391378 missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25393584 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATCTCAATCTCCTCCAGCGCAATG -3'
(R):5'- ATCCTGAAGGACTTCCCTCTGCAC -3'

Sequencing Primer
(F):5'- AGCGCAATGCCCATGATG -3'
(R):5'- GAGTATACACTTGGCCTTTGGAAC -3'
Posted On 2013-07-24