Incidental Mutation 'R7857:Arhgef40'
ID607300
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7857 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51988755 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 85 (H85Q)
Ref Sequence ENSEMBL: ENSMUSP00000091331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: H85Q

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: H85Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: H85Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182193
AA Change: H85Q

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect probably benign
Transcript: ENSMUST00000182760
AA Change: H85Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
AA Change: H85Q

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: H85Q

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183208
AA Change: H85Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562
AA Change: H85Q

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cdon A G 9: 35,456,612 R268G possibly damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Dsg1b A T 18: 20,396,463 M322L probably benign Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Fbxo21 T C 5: 117,988,813 S210P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wbp2nl A G 15: 82,306,072 N67S probably benign Het
Wdr35 T C 12: 9,008,113 probably null Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Zfp934 G A 13: 62,517,547 H459Y Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 51991797 missense unknown
R7935:Arhgef40 UTSW 14 51991797 missense unknown
R7940:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
R8144:Arhgef40 UTSW 14 51998175 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGGGATTTTAACCCATCC -3'
(R):5'- TTTGTGCACAAATCGTGGG -3'

Sequencing Primer
(F):5'- GGGATTTTAACCCATCCAACATAAGG -3'
(R):5'- AATGCCTTGTAGCCACTCAGG -3'
Posted On2019-12-20