Incidental Mutation 'R7857:Wbp2nl'
ID 607305
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene Name WBP2 N-terminal like
Synonyms PAWP, 4930521I23Rik
MMRRC Submission 045910-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7857 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 82183155-82198824 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82190273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 67 (N67S)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
AlphaFold Q9D529
Predicted Effect probably benign
Transcript: ENSMUST00000023089
AA Change: N67S

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: N67S

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,454,104 (GRCm39) N307I probably benign Het
Ahnak G A 19: 8,984,832 (GRCm39) V2039M probably damaging Het
Arhgef40 T A 14: 52,226,212 (GRCm39) H85Q probably damaging Het
Ash1l T A 3: 88,891,616 (GRCm39) L1165* probably null Het
Cck A G 9: 121,322,514 (GRCm39) W100R probably damaging Het
Cdon A G 9: 35,367,908 (GRCm39) R268G possibly damaging Het
Cldn12 T C 5: 5,558,209 (GRCm39) T73A probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctnnd2 A T 15: 30,620,076 (GRCm39) T143S probably benign Het
Cyp2b13 T A 7: 25,788,153 (GRCm39) L427Q possibly damaging Het
Dnah3 A T 7: 119,550,927 (GRCm39) Y152N probably damaging Het
Dsg1b A T 18: 20,529,520 (GRCm39) M322L probably benign Het
Efhc1 T C 1: 21,045,226 (GRCm39) M414T probably benign Het
Elp3 G A 14: 65,800,759 (GRCm39) T302M probably benign Het
Entpd6 T C 2: 150,607,473 (GRCm39) probably null Het
Epb41l4a G T 18: 34,139,098 (GRCm39) C13* probably null Het
Ephb6 T C 6: 41,590,331 (GRCm39) S28P probably benign Het
Fbxo21 T C 5: 118,126,878 (GRCm39) S210P probably benign Het
Gapvd1 T A 2: 34,619,079 (GRCm39) E98V probably benign Het
Gcdh A G 8: 85,619,093 (GRCm39) V157A probably damaging Het
Gm10638 G T 8: 87,472,891 (GRCm39) R188L unknown Het
Grk3 T C 5: 113,109,427 (GRCm39) T177A unknown Het
Gsc T G 12: 104,438,424 (GRCm39) E148A probably damaging Het
Hacd4 C T 4: 88,355,702 (GRCm39) G61E probably damaging Het
Herc3 G A 6: 58,820,637 (GRCm39) W7* probably null Het
Il1rl2 T C 1: 40,366,642 (GRCm39) Y59H probably benign Het
Irag1 T A 7: 110,522,742 (GRCm39) K234* probably null Het
Kif1c A G 11: 70,619,103 (GRCm39) T913A probably benign Het
Lipg C T 18: 75,078,891 (GRCm39) G454R probably damaging Het
Lrrc74a A G 12: 86,788,485 (GRCm39) D155G probably benign Het
Ltf A T 9: 110,851,444 (GRCm39) I137F probably benign Het
Med19 T A 2: 84,515,969 (GRCm39) M166K probably damaging Het
Mei1 A T 15: 81,976,918 (GRCm39) Y167F not run Het
Ncaph A C 2: 126,946,165 (GRCm39) D724E probably damaging Het
Neb T A 2: 52,112,996 (GRCm39) D4266V probably damaging Het
Npffr1 G T 10: 61,449,765 (GRCm39) W13L probably benign Het
Or51b6 A T 7: 103,555,817 (GRCm39) H54L Het
Pcdha12 A T 18: 37,155,468 (GRCm39) D729V probably benign Het
Pcdha7 A T 18: 37,108,892 (GRCm39) E639V probably damaging Het
Pcdhb18 A T 18: 37,624,364 (GRCm39) M565L probably benign Het
Plcd3 A T 11: 102,968,760 (GRCm39) D310E probably benign Het
Pmm2 C G 16: 8,460,632 (GRCm39) Q29E probably benign Het
Poli T G 18: 70,642,225 (GRCm39) E658D probably benign Het
Prss22 G A 17: 24,212,853 (GRCm39) R295C probably damaging Het
Psg26 A G 7: 18,212,215 (GRCm39) I380T possibly damaging Het
Reep5 A T 18: 34,505,521 (GRCm39) V50E possibly damaging Het
Rfx7 A G 9: 72,500,605 (GRCm39) T122A possibly damaging Het
Robo1 A G 16: 72,767,099 (GRCm39) N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 (GRCm38) V711A probably benign Het
Smc4 T C 3: 68,940,552 (GRCm39) V1162A possibly damaging Het
Snta1 A T 2: 154,225,817 (GRCm39) L189H probably benign Het
Tmem121 C T 12: 113,152,696 (GRCm39) R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 (GRCm39) V271A probably damaging Het
Tmx4 T G 2: 134,481,582 (GRCm39) M114L probably benign Het
Trps1 T A 15: 50,524,401 (GRCm39) R1176S probably damaging Het
Usp21 A G 1: 171,114,335 (GRCm39) L63P probably benign Het
Vmn2r84 T A 10: 130,226,738 (GRCm39) M367L probably benign Het
Wdr35 T C 12: 9,058,113 (GRCm39) probably null Het
Zfp236 G A 18: 82,686,726 (GRCm39) Q271* probably null Het
Zfp831 T C 2: 174,547,035 (GRCm39) V1406A probably benign Het
Zfp934 G A 13: 62,665,361 (GRCm39) H459Y Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82,198,411 (GRCm39) missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82,198,491 (GRCm39) missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82,190,619 (GRCm39) missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82,192,806 (GRCm39) missense probably benign
IGL01735:Wbp2nl APN 15 82,198,017 (GRCm39) missense probably benign
IGL01987:Wbp2nl APN 15 82,192,762 (GRCm39) missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82,190,374 (GRCm39) missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82,198,035 (GRCm39) missense probably benign
IGL02971:Wbp2nl APN 15 82,189,945 (GRCm39) missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82,198,483 (GRCm39) missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82,197,988 (GRCm39) missense probably benign
R0242:Wbp2nl UTSW 15 82,197,988 (GRCm39) missense probably benign
R0909:Wbp2nl UTSW 15 82,198,275 (GRCm39) missense probably benign 0.41
R1442:Wbp2nl UTSW 15 82,198,407 (GRCm39) missense probably benign
R1753:Wbp2nl UTSW 15 82,189,945 (GRCm39) missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82,192,762 (GRCm39) missense probably benign 0.07
R4086:Wbp2nl UTSW 15 82,192,762 (GRCm39) missense probably benign 0.07
R4087:Wbp2nl UTSW 15 82,192,762 (GRCm39) missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82,190,255 (GRCm39) missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82,198,537 (GRCm39) missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82,183,246 (GRCm39) missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82,183,246 (GRCm39) missense possibly damaging 0.94
R6820:Wbp2nl UTSW 15 82,197,996 (GRCm39) missense possibly damaging 0.65
R7156:Wbp2nl UTSW 15 82,189,903 (GRCm39) missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82,198,542 (GRCm39) makesense probably null
R7598:Wbp2nl UTSW 15 82,192,762 (GRCm39) missense probably benign 0.07
R7903:Wbp2nl UTSW 15 82,190,332 (GRCm39) nonsense probably null
R9242:Wbp2nl UTSW 15 82,192,748 (GRCm39) missense probably benign 0.22
R9379:Wbp2nl UTSW 15 82,198,311 (GRCm39) missense possibly damaging 0.83
Z1177:Wbp2nl UTSW 15 82,192,765 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCATTTTGAAGAAGGATGGAAG -3'
(R):5'- TGTTTACCCGAGAAGCACAC -3'

Sequencing Primer
(F):5'- TGGAAGAAAAGAGATGATGTTTCTC -3'
(R):5'- ACTCTCAAACAGGCGGGTCAG -3'
Posted On 2019-12-20