Incidental Mutation 'R7857:Wbp2nl'
ID607305
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene NameWBP2 N-terminal like
Synonyms4930521I23Rik, PAWP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7857 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82298954-82314623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82306072 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 67 (N67S)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
Predicted Effect probably benign
Transcript: ENSMUST00000023089
AA Change: N67S

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: N67S

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,490,484 N307I probably benign Het
Ahnak G A 19: 9,007,468 V2039M probably damaging Het
Arhgef40 T A 14: 51,988,755 H85Q probably damaging Het
Ash1l T A 3: 88,984,309 L1165* probably null Het
Cck A G 9: 121,493,448 W100R probably damaging Het
Cdon A G 9: 35,456,612 R268G possibly damaging Het
Cldn12 T C 5: 5,508,209 T73A probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Cyp2b13 T A 7: 26,088,728 L427Q possibly damaging Het
Dnah3 A T 7: 119,951,704 Y152N probably damaging Het
Dsg1b A T 18: 20,396,463 M322L probably benign Het
Efhc1 T C 1: 20,975,002 M414T probably benign Het
Elp3 G A 14: 65,563,310 T302M probably benign Het
Entpd6 T C 2: 150,765,553 probably null Het
Epb41l4a G T 18: 34,006,045 C13* probably null Het
Ephb6 T C 6: 41,613,397 S28P probably benign Het
Fbxo21 T C 5: 117,988,813 S210P probably benign Het
Gapvd1 T A 2: 34,729,067 E98V probably benign Het
Gcdh A G 8: 84,892,464 V157A probably damaging Het
Gm10638 G T 8: 86,746,263 R188L unknown Het
Grk3 T C 5: 112,961,561 T177A unknown Het
Gsc T G 12: 104,472,165 E148A probably damaging Het
Hacd4 C T 4: 88,437,465 G61E probably damaging Het
Herc3 G A 6: 58,843,652 W7* probably null Het
Il1rl2 T C 1: 40,327,482 Y59H probably benign Het
Kif1c A G 11: 70,728,277 T913A probably benign Het
Lipg C T 18: 74,945,820 G454R probably damaging Het
Lrrc74a A G 12: 86,741,711 D155G probably benign Het
Ltf A T 9: 111,022,376 I137F probably benign Het
Med19 T A 2: 84,685,625 M166K probably damaging Het
Mei1 A T 15: 82,092,717 Y167F not run Het
Mrvi1 T A 7: 110,923,535 K234* probably null Het
Ncaph A C 2: 127,104,245 D724E probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Npffr1 G T 10: 61,613,986 W13L probably benign Het
Olfr65 A T 7: 103,906,610 H54L Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Pcdha7 A T 18: 36,975,839 E639V probably damaging Het
Pcdhb18 A T 18: 37,491,311 M565L probably benign Het
Plcd3 A T 11: 103,077,934 D310E probably benign Het
Pmm2 C G 16: 8,642,768 Q29E probably benign Het
Poli T G 18: 70,509,154 E658D probably benign Het
Prss22 G A 17: 23,993,879 R295C probably damaging Het
Psg26 A G 7: 18,478,290 I380T possibly damaging Het
Reep5 A T 18: 34,372,468 V50E possibly damaging Het
Rfx7 A G 9: 72,593,323 T122A possibly damaging Het
Robo1 A G 16: 72,970,211 N424D probably damaging Het
Slc4a7 T C 14: 14,772,624 V711A probably benign Het
Smc4 T C 3: 69,033,219 V1162A possibly damaging Het
Snta1 A T 2: 154,383,897 L189H probably benign Het
Tmem121 C T 12: 113,189,076 R305C possibly damaging Het
Tmem68 A G 4: 3,551,825 V271A probably damaging Het
Tmx4 T G 2: 134,639,662 M114L probably benign Het
Trps1 T A 15: 50,661,005 R1176S probably damaging Het
Usp21 A G 1: 171,286,762 L63P probably benign Het
Vmn2r84 T A 10: 130,390,869 M367L probably benign Het
Wdr35 T C 12: 9,008,113 probably null Het
Zfp236 G A 18: 82,668,601 Q271* probably null Het
Zfp831 T C 2: 174,705,242 V1406A probably benign Het
Zfp934 G A 13: 62,517,547 H459Y Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82314210 missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82314290 missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82306418 missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82308605 missense probably benign
IGL01735:Wbp2nl APN 15 82313816 missense probably benign
IGL01987:Wbp2nl APN 15 82308561 missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82306173 missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82313834 missense probably benign
IGL02971:Wbp2nl APN 15 82305744 missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82314282 missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0909:Wbp2nl UTSW 15 82314074 missense probably benign 0.41
R1442:Wbp2nl UTSW 15 82314206 missense probably benign
R1753:Wbp2nl UTSW 15 82305744 missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4086:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4087:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82306054 missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82314336 missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6820:Wbp2nl UTSW 15 82313795 missense possibly damaging 0.65
R7156:Wbp2nl UTSW 15 82305702 missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82314341 makesense probably null
R7598:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R7903:Wbp2nl UTSW 15 82306131 nonsense probably null
Z1177:Wbp2nl UTSW 15 82308564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCATTTTGAAGAAGGATGGAAG -3'
(R):5'- TGTTTACCCGAGAAGCACAC -3'

Sequencing Primer
(F):5'- TGGAAGAAAAGAGATGATGTTTCTC -3'
(R):5'- ACTCTCAAACAGGCGGGTCAG -3'
Posted On2019-12-20