Incidental Mutation 'R7858:Olfr1183'
ID607323
Institutional Source Beutler Lab
Gene Symbol Olfr1183
Ensembl Gene ENSMUSG00000049372
Gene Nameolfactory receptor 1183
SynonymsGA_x6K02T2Q125-49948903-49949814, MOR230-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88454867-88469199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88461712 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 143 (C143Y)
Ref Sequence ENSEMBL: ENSMUSP00000154094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102618] [ENSMUST00000213115] [ENSMUST00000219871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102618
AA Change: C124Y

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099678
Gene: ENSMUSG00000049372
AA Change: C124Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 299 1.8e-5 PFAM
Pfam:7tm_1 38 284 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213115
AA Change: C143Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219871
AA Change: C124Y

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Olfr1183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1183 APN 2 88461352 missense probably benign
IGL01150:Olfr1183 APN 2 88462075 missense possibly damaging 0.93
IGL02894:Olfr1183 APN 2 88461726 missense probably damaging 1.00
R0382:Olfr1183 UTSW 2 88461725 missense possibly damaging 0.87
R0401:Olfr1183 UTSW 2 88461925 missense probably damaging 1.00
R0664:Olfr1183 UTSW 2 88462171 missense probably damaging 1.00
R1990:Olfr1183 UTSW 2 88461342 start codon destroyed probably null
R3122:Olfr1183 UTSW 2 88461509 missense probably damaging 0.99
R4596:Olfr1183 UTSW 2 88462194 missense probably benign 0.28
R7361:Olfr1183 UTSW 2 88461492 missense probably benign 0.28
R7469:Olfr1183 UTSW 2 88461347 missense probably benign
R8023:Olfr1183 UTSW 2 88461678 missense probably benign 0.04
R8147:Olfr1183 UTSW 2 88462083 missense possibly damaging 0.93
Z1176:Olfr1183 UTSW 2 88462114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTCAGACACTTGGGAGTC -3'
(R):5'- CAATAAGGGCTGCAAATCGC -3'

Sequencing Primer
(F):5'- GGGAGTCCCATGTACTTTTTCC -3'
(R):5'- GCAAATCGCAGAAATAATGATCAATC -3'
Posted On2019-12-20