Incidental Mutation 'R7858:Zfp704'
ID607325
Institutional Source Beutler Lab
Gene Symbol Zfp704
Ensembl Gene ENSMUSG00000040209
Gene Namezinc finger protein 704
SynonymsGig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location9427020-9610085 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 9444157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041124] [ENSMUST00000193947]
Predicted Effect probably benign
Transcript: ENSMUST00000041124
SMART Domains Protein: ENSMUSP00000041242
Gene: ENSMUSG00000040209

DomainStartEndE-ValueType
low complexity region 12 94 N/A INTRINSIC
low complexity region 98 129 N/A INTRINSIC
low complexity region 267 290 N/A INTRINSIC
ZnF_C2H2 346 371 3.58e-2 SMART
c-clamp 536 566 1.55e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193947
SMART Domains Protein: ENSMUSP00000141598
Gene: ENSMUSG00000040209

DomainStartEndE-ValueType
low complexity region 117 140 N/A INTRINSIC
ZnF_C2H2 196 221 1.6e-4 SMART
c-clamp 475 505 7.4e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile with no obvious developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Zfp704
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Zfp704 APN 3 9565239 missense possibly damaging 0.61
IGL03288:Zfp704 APN 3 9439891 splice site probably benign
R0265:Zfp704 UTSW 3 9565157 missense probably damaging 1.00
R0524:Zfp704 UTSW 3 9609364 missense unknown
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1647:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1648:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1865:Zfp704 UTSW 3 9474491 splice site probably benign
R1912:Zfp704 UTSW 3 9609358 missense unknown
R2109:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R2566:Zfp704 UTSW 3 9609493 missense unknown
R3551:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R4495:Zfp704 UTSW 3 9471077 missense probably benign 0.01
R6165:Zfp704 UTSW 3 9443886 missense probably benign 0.00
R6682:Zfp704 UTSW 3 9565193 missense probably benign 0.11
R7057:Zfp704 UTSW 3 9470917 missense probably damaging 1.00
R7348:Zfp704 UTSW 3 9474598 missense probably damaging 1.00
R7758:Zfp704 UTSW 3 9444222 missense possibly damaging 0.90
R8104:Zfp704 UTSW 3 9565241 missense probably benign 0.03
R8373:Zfp704 UTSW 3 9609442 missense unknown
Z1176:Zfp704 UTSW 3 9471044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAGCTGAAATTGGAAC -3'
(R):5'- TGATTTGCCATTTGACACTACCTG -3'

Sequencing Primer
(F):5'- GATTTAGCATACACACCTCTGGGAG -3'
(R):5'- CTGGACATGCCTCTGGGAAATTATC -3'
Posted On2019-12-20