Incidental Mutation 'R7858:Kti12'
ID607330
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108848246 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 119 (E119A)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119A

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTGACGCCAAACATCCG -3'
(R):5'- TCTGGATCCAGTTCCTTTGAG -3'

Sequencing Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2019-12-20