Incidental Mutation 'R7858:Mansc1'
ID607333
Institutional Source Beutler Lab
Gene Symbol Mansc1
Ensembl Gene ENSMUSG00000032718
Gene NameMANSC domain containing 1
Synonyms9130403P13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134609207-134632488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134610414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000038346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047443]
Predicted Effect probably benign
Transcript: ENSMUST00000047443
AA Change: T267A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038346
Gene: ENSMUSG00000032718
AA Change: T267A

DomainStartEndE-ValueType
MANEC 23 116 3.87e-44 SMART
low complexity region 219 231 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Mansc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Mansc1 APN 6 134610806 missense possibly damaging 0.88
IGL01141:Mansc1 APN 6 134621785 missense probably benign 0.21
IGL01447:Mansc1 APN 6 134617326 missense probably damaging 0.96
IGL01582:Mansc1 APN 6 134621873 missense possibly damaging 0.95
IGL02121:Mansc1 APN 6 134621837 missense probably damaging 1.00
IGL02214:Mansc1 APN 6 134610360 missense probably benign 0.39
IGL02466:Mansc1 APN 6 134610851 missense probably damaging 1.00
IGL02699:Mansc1 APN 6 134610354 missense probably benign 0.34
R0266:Mansc1 UTSW 6 134610707 missense probably benign 0.08
R0730:Mansc1 UTSW 6 134617461 splice site probably benign
R0849:Mansc1 UTSW 6 134610707 missense probably benign 0.08
R2015:Mansc1 UTSW 6 134610311 missense possibly damaging 0.77
R3874:Mansc1 UTSW 6 134610183 missense possibly damaging 0.62
R4886:Mansc1 UTSW 6 134610662 missense probably benign 0.01
R5864:Mansc1 UTSW 6 134610853 critical splice acceptor site probably null
R5932:Mansc1 UTSW 6 134610515 missense possibly damaging 0.69
R7233:Mansc1 UTSW 6 134621843 missense probably damaging 0.98
R7576:Mansc1 UTSW 6 134610711 missense possibly damaging 0.87
R7981:Mansc1 UTSW 6 134610311 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGAAGACTCTGAGGTTGAGC -3'
(R):5'- AAAGCCATTCTCAGAGTTTACAGC -3'

Sequencing Primer
(F):5'- AAGACTCTGAGGTTGAGCTTTTCCC -3'
(R):5'- GAGTTTACAGCTTCCCTCAGAAC -3'
Posted On2019-12-20