Incidental Mutation 'R7858:Cyld'
ID607338
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88709988 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 302 (I302N)
Ref Sequence ENSEMBL: ENSMUSP00000039834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect probably damaging
Transcript: ENSMUST00000043526
AA Change: I302N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: I302N

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098519
AA Change: I302N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: I302N

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109626
AA Change: I302N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: I302N

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209206
AA Change: I302N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000209532
AA Change: I302N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209559
AA Change: I302N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211554
AA Change: I302N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5533 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0122:Cyld UTSW 8 88742292 missense probably damaging 1.00
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4260:Cyld UTSW 8 88741391 missense probably damaging 1.00
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R4975:Cyld UTSW 8 88707232 missense probably benign
R5375:Cyld UTSW 8 88733036 missense possibly damaging 0.77
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
R7667:Cyld UTSW 8 88742302 missense probably benign 0.01
R7912:Cyld UTSW 8 88734897 missense probably damaging 1.00
R8076:Cyld UTSW 8 88729718 missense probably benign 0.00
R8276:Cyld UTSW 8 88734928 missense probably benign 0.06
R8282:Cyld UTSW 8 88705415 missense probably benign 0.06
R8348:Cyld UTSW 8 88729569 missense probably damaging 1.00
RF016:Cyld UTSW 8 88705441 nonsense probably null
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCAAAGTAGTTAAAGGTTCTC -3'
(R):5'- TGCCTAGGAGACAACAATGTAAC -3'

Sequencing Primer
(F):5'- GGCTTAAAGGCTTCCTTTG -3'
(R):5'- CAATTCTGCCTTATAAAACCC -3'
Posted On2019-12-20