Incidental Mutation 'R7858:Prmt7'
ID607339
Institutional Source Beutler Lab
Gene Symbol Prmt7
Ensembl Gene ENSMUSG00000060098
Gene Nameprotein arginine N-methyltransferase 7
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106210936-106252794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106244688 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 452 (I452S)
Ref Sequence ENSEMBL: ENSMUSP00000071521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071592]
PDB Structure
Crystal structure of mouse protein arginine methyltransferase 7 in complex with SAH [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071592
AA Change: I452S

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071521
Gene: ENSMUSG00000060098
AA Change: I452S

DomainStartEndE-ValueType
Pfam:PrmA 53 148 1.6e-7 PFAM
internal_repeat_1 382 652 1.71e-8 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is an apparently irreversible protein modification catalyzed by arginine methyltransferases, such as PMT7, using S-adenosylmethionine (AdoMet) as the methyl donor. Arginine methylation is implicated in signal transduction, RNA transport, and RNA splicing (Miranda et al., 2004 [PubMed 15044439]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Prmt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Prmt7 APN 8 106237214 splice site probably benign
IGL01565:Prmt7 APN 8 106250409 missense probably damaging 0.97
IGL02245:Prmt7 APN 8 106237305 missense probably benign 0.10
R0104:Prmt7 UTSW 8 106237350 missense probably damaging 0.99
R0255:Prmt7 UTSW 8 106227207 splice site probably benign
R1432:Prmt7 UTSW 8 106237284 nonsense probably null
R1551:Prmt7 UTSW 8 106237382 missense probably benign
R1848:Prmt7 UTSW 8 106237008 missense probably benign
R2117:Prmt7 UTSW 8 106227298 missense probably damaging 0.96
R3784:Prmt7 UTSW 8 106242136 missense probably benign 0.01
R4599:Prmt7 UTSW 8 106250329 missense possibly damaging 0.80
R4940:Prmt7 UTSW 8 106237278 missense probably benign 0.01
R4983:Prmt7 UTSW 8 106250363 missense probably damaging 1.00
R5285:Prmt7 UTSW 8 106248359 missense probably benign 0.15
R6015:Prmt7 UTSW 8 106235008 intron probably benign
R6520:Prmt7 UTSW 8 106234884 missense probably damaging 1.00
R7097:Prmt7 UTSW 8 106235100 missense unknown
R7122:Prmt7 UTSW 8 106235100 missense unknown
R7233:Prmt7 UTSW 8 106220010 missense probably damaging 0.99
R7538:Prmt7 UTSW 8 106237386 missense probably benign 0.02
R7577:Prmt7 UTSW 8 106242203 missense probably damaging 1.00
R7659:Prmt7 UTSW 8 106237286 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGACATGGTAACTTTGAGAG -3'
(R):5'- TGGCCAAGCTACATGAGAGAC -3'

Sequencing Primer
(F):5'- GCTTTTTATGATGCTGCAGATTGAAC -3'
(R):5'- TGAGAGACATCACACAGCATTTAG -3'
Posted On2019-12-20