Incidental Mutation 'R7858:Gm1123'
ID607340
Institutional Source Beutler Lab
Gene Symbol Gm1123
Ensembl Gene ENSMUSG00000044860
Gene Namepredicted gene 1123
SynonymsLOC382097
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99006790-99035715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99014054 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 258 (N258D)
Ref Sequence ENSEMBL: ENSMUSP00000076020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076730
AA Change: N258D

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076020
Gene: ENSMUSG00000044860
AA Change: N258D

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
IGv 36 123 1.85e-7 SMART
IG 151 264 3.33e-9 SMART
IGv 286 373 6.02e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Gm1123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Gm1123 APN 9 99023254 missense probably benign
IGL02502:Gm1123 APN 9 99009390 nonsense probably null
R0091:Gm1123 UTSW 9 99023352 missense possibly damaging 0.80
R4628:Gm1123 UTSW 9 99014236 missense probably damaging 0.98
R4668:Gm1123 UTSW 9 99009373 missense probably damaging 1.00
R4754:Gm1123 UTSW 9 99023240 splice site probably null
R4754:Gm1123 UTSW 9 99023241 critical splice donor site probably null
R4778:Gm1123 UTSW 9 99018507 missense probably benign
R4840:Gm1123 UTSW 9 99018569 missense probably damaging 0.98
R4905:Gm1123 UTSW 9 99009316 missense probably benign 0.16
R5645:Gm1123 UTSW 9 99014191 missense probably benign 0.41
R5685:Gm1123 UTSW 9 99009433 critical splice acceptor site probably null
R7390:Gm1123 UTSW 9 99010980 missense probably benign 0.19
R8196:Gm1123 UTSW 9 99023256 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGGATGTTACAATACCCCAAAG -3'
(R):5'- TGCAGACAAAATTCATGACGACG -3'

Sequencing Primer
(F):5'- GTGTCAGAACCTTCCCTAGTAAG -3'
(R):5'- ATTCATGACGACGTCTATCCAG -3'
Posted On2019-12-20