Incidental Mutation 'R7858:Cspg5'
ID607341
Institutional Source Beutler Lab
Gene Symbol Cspg5
Ensembl Gene ENSMUSG00000032482
Gene Namechondroitin sulfate proteoglycan 5
SynonymsCALEB, neuroglycan C, NGC
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110243783-110262576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110251066 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 434 (L434P)
Ref Sequence ENSEMBL: ENSMUSP00000035058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035058] [ENSMUST00000196060] [ENSMUST00000197850] [ENSMUST00000199736]
Predicted Effect probably damaging
Transcript: ENSMUST00000035058
AA Change: L434P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035058
Gene: ENSMUSG00000032482
AA Change: L434P

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Chon_Sulph_att 33 278 2.5e-123 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 565 5.8e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196060
AA Change: L434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143164
Gene: ENSMUSG00000032482
AA Change: L434P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 487 8.9e-26 PFAM
Pfam:Neural_ProG_Cyt 486 539 1.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197850
AA Change: L434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143005
Gene: ENSMUSG00000032482
AA Change: L434P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1.1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 520 1.5e-45 PFAM
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199736
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142845
Gene: ENSMUSG00000032482
AA Change: L353P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 1 197 1.6e-99 PFAM
low complexity region 209 221 N/A INTRINSIC
EGF 292 332 9.5e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 366 406 1.2e-22 PFAM
Pfam:Neural_ProG_Cyt 405 458 1.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a chondroitin sulfate proteoglycan. The encoded protein has been termed a 'part-time' proteoglycan, as chondroitin sulfate chains appear to be attached to the protein in the developing but not the adult cerebellum and retina. It is thought that this protein plays roles in dendrite branching and synapse formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display decreased spontaneous postsynaptic currents, increased paired-pulse ratios, and reduced long term depression during early postnatal developmental stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Cspg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cspg5 APN 9 110256168 missense probably damaging 1.00
IGL01516:Cspg5 APN 9 110246693 missense probably benign 0.37
IGL01800:Cspg5 APN 9 110251150 splice site probably benign
IGL01927:Cspg5 APN 9 110262084 missense probably damaging 0.99
IGL02164:Cspg5 APN 9 110251036 missense probably damaging 0.98
IGL02338:Cspg5 APN 9 110256267 missense probably benign 0.04
IGL02421:Cspg5 APN 9 110247392 critical splice donor site probably benign
R0106:Cspg5 UTSW 9 110246532 missense probably damaging 0.96
R0540:Cspg5 UTSW 9 110247392 critical splice donor site probably null
R0905:Cspg5 UTSW 9 110246526 missense probably damaging 0.99
R1772:Cspg5 UTSW 9 110262138 missense probably damaging 1.00
R1959:Cspg5 UTSW 9 110251026 missense probably damaging 1.00
R4356:Cspg5 UTSW 9 110256177 missense probably damaging 1.00
R4771:Cspg5 UTSW 9 110251127 missense probably damaging 1.00
R5345:Cspg5 UTSW 9 110246630 missense probably benign 0.03
R5441:Cspg5 UTSW 9 110246643 missense probably benign
R5474:Cspg5 UTSW 9 110251008 missense probably damaging 1.00
R5946:Cspg5 UTSW 9 110251083 missense probably damaging 0.99
R6890:Cspg5 UTSW 9 110246784 missense probably damaging 0.98
R7028:Cspg5 UTSW 9 110246891 missense possibly damaging 0.85
R7286:Cspg5 UTSW 9 110246955 missense probably damaging 1.00
R7697:Cspg5 UTSW 9 110256226 missense probably damaging 0.99
X0020:Cspg5 UTSW 9 110247173 missense probably damaging 0.96
Z1176:Cspg5 UTSW 9 110251050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAGCAGGCTATTGAGTTG -3'
(R):5'- AACTTTTAGCATGAGCCAAAGGG -3'

Sequencing Primer
(F):5'- AGTGTTGTTGGCATCAGAGC -3'
(R):5'- GCTAGAGAACAGGTGCCAGACC -3'
Posted On2019-12-20