Incidental Mutation 'R7858:Apon'
ID607342
Institutional Source Beutler Lab
Gene Symbol Apon
Ensembl Gene ENSMUSG00000051716
Gene Nameapolipoprotein N
SynonymsD10Ucla2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128254096-128255896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128254459 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2 (I2T)
Ref Sequence ENSEMBL: ENSMUSP00000059142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000060782] [ENSMUST00000105242] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000218722]
Predicted Effect probably benign
Transcript: ENSMUST00000055539
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060782
AA Change: I2T

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059142
Gene: ENSMUSG00000051716
AA Change: I2T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipo_F 50 247 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105242
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105244
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218722
AA Change: I2T

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Apon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Apon APN 10 128254954 missense probably damaging 1.00
IGL03340:Apon APN 10 128254978 missense probably benign 0.01
R1704:Apon UTSW 10 128254996 missense probably damaging 1.00
R2178:Apon UTSW 10 128254765 missense probably benign 0.01
R4853:Apon UTSW 10 128255082 missense probably benign 0.13
R5323:Apon UTSW 10 128255038 missense probably damaging 1.00
R6385:Apon UTSW 10 128254354 start gained probably benign
R7354:Apon UTSW 10 128254738 missense probably benign 0.18
R7567:Apon UTSW 10 128255053 missense possibly damaging 0.73
R7759:Apon UTSW 10 128254515 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGGTAACAGCCTCTAAGAG -3'
(R):5'- ACAACTCTCAGGGCTAAGAGG -3'

Sequencing Primer
(F):5'- GAGGCCCCCTCTTATGTCCAG -3'
(R):5'- CTCTCAGGGCTAAGAGGGACAAG -3'
Posted On2019-12-20