Incidental Mutation 'R7858:Zfp758'
ID607347
Institutional Source Beutler Lab
Gene Symbol Zfp758
Ensembl Gene ENSMUSG00000044501
Gene Namezinc finger protein 758
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location22361453-22377281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22375378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 282 (T282A)
Ref Sequence ENSEMBL: ENSMUSP00000121288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072477] [ENSMUST00000088765] [ENSMUST00000121315] [ENSMUST00000149699]
Predicted Effect probably benign
Transcript: ENSMUST00000072477
AA Change: T250A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072298
Gene: ENSMUSG00000044501
AA Change: T250A

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088765
AA Change: T250A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086143
Gene: ENSMUSG00000044501
AA Change: T250A

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121315
AA Change: T250A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113532
Gene: ENSMUSG00000044501
AA Change: T250A

DomainStartEndE-ValueType
KRAB 13 73 1.55e-20 SMART
ZnF_C2H2 177 199 6.92e0 SMART
ZnF_C2H2 205 227 6.32e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 9.08e-4 SMART
ZnF_C2H2 289 311 6.08e-5 SMART
ZnF_C2H2 317 339 1.03e-2 SMART
ZnF_C2H2 345 367 2.24e-3 SMART
ZnF_C2H2 373 395 3.21e-4 SMART
ZnF_C2H2 401 423 6.32e-3 SMART
ZnF_C2H2 429 451 2.24e-3 SMART
ZnF_C2H2 457 479 5.14e-3 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
ZnF_C2H2 513 535 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149699
AA Change: T282A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121288
Gene: ENSMUSG00000044501
AA Change: T282A

DomainStartEndE-ValueType
KRAB 45 105 1.55e-20 SMART
ZnF_C2H2 209 231 6.92e0 SMART
ZnF_C2H2 237 259 6.32e-3 SMART
ZnF_C2H2 265 287 1.2e-3 SMART
ZnF_C2H2 293 315 9.08e-4 SMART
ZnF_C2H2 321 343 6.08e-5 SMART
ZnF_C2H2 349 371 1.03e-2 SMART
ZnF_C2H2 377 399 2.24e-3 SMART
ZnF_C2H2 405 427 3.21e-4 SMART
ZnF_C2H2 433 455 6.32e-3 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 489 511 5.14e-3 SMART
ZnF_C2H2 517 539 1.04e-3 SMART
ZnF_C2H2 545 567 4.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Zfp758
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Zfp758 APN 17 22375040 missense probably damaging 1.00
R1034:Zfp758 UTSW 17 22375759 nonsense probably null
R1187:Zfp758 UTSW 17 22375190 missense probably benign 0.23
R1733:Zfp758 UTSW 17 22375849 missense probably damaging 1.00
R1847:Zfp758 UTSW 17 22375223 missense probably benign 0.19
R1927:Zfp758 UTSW 17 22375842 missense probably damaging 0.99
R1934:Zfp758 UTSW 17 22373652 missense probably damaging 0.99
R2113:Zfp758 UTSW 17 22361645 missense probably benign 0.10
R2132:Zfp758 UTSW 17 22375970 missense probably damaging 1.00
R5134:Zfp758 UTSW 17 22375405 missense probably damaging 1.00
R5274:Zfp758 UTSW 17 22375855 missense probably benign 0.31
R5303:Zfp758 UTSW 17 22374861 missense probably benign 0.05
R5394:Zfp758 UTSW 17 22372068 missense probably damaging 0.99
R5813:Zfp758 UTSW 17 22375815 missense probably damaging 1.00
R6017:Zfp758 UTSW 17 22373731 missense probably damaging 1.00
R6411:Zfp758 UTSW 17 22375094 missense possibly damaging 0.85
R6501:Zfp758 UTSW 17 22371997 intron probably benign
R6805:Zfp758 UTSW 17 22361669 missense probably benign 0.00
R7076:Zfp758 UTSW 17 22375156 missense probably benign 0.11
R7147:Zfp758 UTSW 17 22376000 missense possibly damaging 0.75
R7170:Zfp758 UTSW 17 22375135 nonsense probably null
R7572:Zfp758 UTSW 17 22374891 missense possibly damaging 0.61
R7593:Zfp758 UTSW 17 22374958 missense probably damaging 0.98
R7699:Zfp758 UTSW 17 22375665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACTCTAACCAAAACCTCATGCTG -3'
(R):5'- CTCTGATGACCTCTAAGATCACTTTTG -3'

Sequencing Primer
(F):5'- TGCTTCATCCAGAAAGGTGATC -3'
(R):5'- GTTGGTAAAGCATTTGTCACACTCAC -3'
Posted On2019-12-20