Incidental Mutation 'R7858:Zfp35'
ID607349
Institutional Source Beutler Lab
Gene Symbol Zfp35
Ensembl Gene ENSMUSG00000063281
Gene Namezinc finger protein 35
SynonymsZfp-35
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location23989632-24005376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24003840 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 414 (C414R)
Ref Sequence ENSEMBL: ENSMUSP00000074475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074941]
Predicted Effect probably damaging
Transcript: ENSMUST00000074941
AA Change: C414R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074475
Gene: ENSMUSG00000063281
AA Change: C414R

DomainStartEndE-ValueType
ZnF_C2H2 78 100 1.28e-3 SMART
ZnF_C2H2 104 126 8.47e-4 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 1.84e-4 SMART
ZnF_C2H2 188 210 7.37e-4 SMART
ZnF_C2H2 216 238 4.72e-2 SMART
ZnF_C2H2 244 266 2.4e-3 SMART
ZnF_C2H2 272 294 1.04e-3 SMART
ZnF_C2H2 300 322 3.69e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 1.5e-4 SMART
ZnF_C2H2 384 406 1.6e-4 SMART
ZnF_C2H2 412 434 3.89e-3 SMART
ZnF_C2H2 440 462 1.72e-4 SMART
ZnF_C2H2 468 490 2.71e-2 SMART
ZnF_C2H2 496 518 1.6e-4 SMART
ZnF_C2H2 524 545 2.17e1 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out mutation exhibit increased airway responsiveness to ovalbumin and methacholine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Zfp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0012:Zfp35 UTSW 18 24002944 missense probably benign 0.01
R1453:Zfp35 UTSW 18 24003500 nonsense probably null
R1807:Zfp35 UTSW 18 24003929 missense probably benign 0.28
R2317:Zfp35 UTSW 18 24003498 missense probably damaging 1.00
R2863:Zfp35 UTSW 18 24004295 missense probably damaging 0.99
R3080:Zfp35 UTSW 18 24003310 missense probably damaging 0.99
R3756:Zfp35 UTSW 18 24002925 missense possibly damaging 0.88
R4114:Zfp35 UTSW 18 24002709 missense probably benign 0.08
R4222:Zfp35 UTSW 18 24003189 missense possibly damaging 0.91
R4780:Zfp35 UTSW 18 24003269 missense probably damaging 1.00
R5137:Zfp35 UTSW 18 24004137 nonsense probably null
R5261:Zfp35 UTSW 18 24003721 missense probably damaging 0.98
R5375:Zfp35 UTSW 18 24002916 missense possibly damaging 0.83
R6001:Zfp35 UTSW 18 24002759 missense probably benign
R6190:Zfp35 UTSW 18 24004061 missense probably benign 0.00
R6774:Zfp35 UTSW 18 24002958 missense possibly damaging 0.51
R6850:Zfp35 UTSW 18 24002782 missense possibly damaging 0.76
R6979:Zfp35 UTSW 18 24003870 missense probably benign 0.32
R7029:Zfp35 UTSW 18 24003526 missense probably damaging 0.98
R7079:Zfp35 UTSW 18 24003300 missense possibly damaging 0.89
R8257:Zfp35 UTSW 18 24004231 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACCGGAGAGAAGCCTTACCC -3'
(R):5'- CGGTTTCTCTCCAGTGTGG -3'

Sequencing Primer
(F):5'- GAAGCCTTACCCATGTAGTCAGTG -3'
(R):5'- GCACTGTGTACACGCATATG -3'
Posted On2019-12-20