Incidental Mutation 'R7859:Pax8'
ID607351
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Namepaired box 8
SynonymsPax-8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24420560-24475599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24421555 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 456 (H456L)
Ref Sequence ENSEMBL: ENSMUSP00000028355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000149294] [ENSMUST00000153601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028355
AA Change: H456L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: H456L

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149294
AA Change: I401F
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976
AA Change: I401F

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24421391 unclassified probably benign
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2289:Pax8 UTSW 2 24440740 missense probably benign 0.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R5924:Pax8 UTSW 2 24421622 missense probably damaging 0.97
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
R7658:Pax8 UTSW 2 24436511 missense probably benign 0.00
R7660:Pax8 UTSW 2 24436561 missense probably benign
R7690:Pax8 UTSW 2 24441670 missense probably benign 0.37
R7775:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24429597 missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24422971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGTTTGGCCTTCTCCAAG -3'
(R):5'- ATCTTTGATGATCAGATGGGCG -3'

Sequencing Primer
(F):5'- AAGGTCATCCTGACTTTCATGG -3'
(R):5'- CGTGGGGGATAAATGATTAACTTG -3'
Posted On2019-12-20