Incidental Mutation 'R7859:Slc43a1'
ID607352
Institutional Source Beutler Lab
Gene Symbol Slc43a1
Ensembl Gene ENSMUSG00000027075
Gene Namesolute carrier family 43, member 1
SynonymsLat3, Pov1, PB39, 2610016F07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84838850-84863594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84856876 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 374 (F374L)
Ref Sequence ENSEMBL: ENSMUSP00000028469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028469] [ENSMUST00000111624] [ENSMUST00000111625] [ENSMUST00000121114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028469
AA Change: F374L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028469
Gene: ENSMUSG00000027075
AA Change: F374L

DomainStartEndE-ValueType
Pfam:MFS_1 60 542 6.2e-14 PFAM
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111624
AA Change: F331L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107251
Gene: ENSMUSG00000027075
AA Change: F331L

DomainStartEndE-ValueType
Pfam:MFS_1 16 499 3.7e-14 PFAM
transmembrane domain 516 538 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111625
AA Change: F357L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107252
Gene: ENSMUSG00000027075
AA Change: F357L

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:MFS_1 49 524 2.7e-13 PFAM
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121114
AA Change: F331L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112642
Gene: ENSMUSG00000027075
AA Change: F331L

DomainStartEndE-ValueType
Pfam:MFS_1 16 499 3.7e-14 PFAM
transmembrane domain 516 538 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC43A1 belongs to the system L family of plasma membrane carrier proteins that transports large neutral amino acids (Babu et al., 2003 [PubMed 12930836]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Slc43a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02326:Slc43a1 APN 2 84849771 missense probably damaging 1.00
IGL02480:Slc43a1 APN 2 84839584 missense probably benign 0.02
IGL02740:Slc43a1 APN 2 84859750 missense probably damaging 1.00
IGL02972:Slc43a1 APN 2 84860118 missense probably damaging 1.00
IGL03046:Slc43a1 APN 2 84854553 unclassified probably benign
IGL03166:Slc43a1 APN 2 84857356 missense possibly damaging 0.91
R1470:Slc43a1 UTSW 2 84859676 splice site probably benign
R1982:Slc43a1 UTSW 2 84856889 missense possibly damaging 0.94
R2087:Slc43a1 UTSW 2 84849831 missense probably damaging 1.00
R2141:Slc43a1 UTSW 2 84840961 missense probably damaging 1.00
R2969:Slc43a1 UTSW 2 84857335 missense probably damaging 1.00
R6208:Slc43a1 UTSW 2 84856840 missense possibly damaging 0.54
R6362:Slc43a1 UTSW 2 84859784 missense probably damaging 1.00
R7341:Slc43a1 UTSW 2 84862934 missense probably damaging 1.00
R7768:Slc43a1 UTSW 2 84856871 missense probably damaging 1.00
R7776:Slc43a1 UTSW 2 84840853 missense probably damaging 1.00
R8082:Slc43a1 UTSW 2 84856900 missense probably benign
R8240:Slc43a1 UTSW 2 84859823 missense possibly damaging 0.67
X0019:Slc43a1 UTSW 2 84855583 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CTTCCTCTCTGAAGTCACACAG -3'
(R):5'- TCTCTGTGGGTAGAGGAGAGAC -3'

Sequencing Primer
(F):5'- ACACTAGTTCCATATGAGCTGAACAG -3'
(R):5'- ACATGGTAATCGGATGCTTAGCC -3'
Posted On2019-12-20