Incidental Mutation 'R7859:Dmtf1'
ID607357
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Namecyclin D binding myb-like transcription factor 1
SynonymsDmp1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location9118801-9161776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9128044 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 372 (S372G)
Ref Sequence ENSEMBL: ENSMUSP00000071815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
Predicted Effect probably damaging
Transcript: ENSMUST00000071921
AA Change: S372G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: S372G

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095017
AA Change: S372G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: S372G

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000183973
AA Change: S284G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: S284G

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000184159
AA Change: S331G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: S331G

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184370
Predicted Effect probably benign
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9132454 critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9140384 critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4467:Dmtf1 UTSW 5 9136085 missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9130654 intron probably benign
R7242:Dmtf1 UTSW 5 9149016 missense possibly damaging 0.90
R7706:Dmtf1 UTSW 5 9124489 missense possibly damaging 0.86
R7721:Dmtf1 UTSW 5 9126564 missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9140453 missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9122457 unclassified probably benign
R7883:Dmtf1 UTSW 5 9140397 missense probably benign 0.35
R8269:Dmtf1 UTSW 5 9132500 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAAAGCCTGCCATAATGG -3'
(R):5'- GTTCTTAGGCTAATTTGCACTGC -3'

Sequencing Primer
(F):5'- GGCAAAGAGCTTGTAACC -3'
(R):5'- AGGCTAATTTGCACTGCTGAAGTC -3'
Posted On2019-12-20