Incidental Mutation 'R7859:Vmn2r27'
ID607359
Institutional Source Beutler Lab
Gene Symbol Vmn2r27
Ensembl Gene ENSMUSG00000072778
Gene Namevomeronasal 2, receptor27
SynonymsEG232367
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124191596-124231784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124224242 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 252 (I252K)
Ref Sequence ENSEMBL: ENSMUSP00000098528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100968]
Predicted Effect probably benign
Transcript: ENSMUST00000100968
AA Change: I252K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: I252K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 81 475 1.1e-27 PFAM
Pfam:NCD3G 519 570 1.3e-18 PFAM
Pfam:7tm_3 603 838 2.6e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Vmn2r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Vmn2r27 APN 6 124192411 missense possibly damaging 0.86
IGL01388:Vmn2r27 APN 6 124223832 missense possibly damaging 0.55
IGL01923:Vmn2r27 APN 6 124200525 missense probably benign 0.20
IGL01954:Vmn2r27 APN 6 124192248 missense probably damaging 1.00
IGL02105:Vmn2r27 APN 6 124197349 splice site probably benign
IGL02586:Vmn2r27 APN 6 124224475 nonsense probably null
IGL03130:Vmn2r27 APN 6 124192317 missense possibly damaging 0.82
IGL03330:Vmn2r27 APN 6 124230180 nonsense probably null
R0124:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0384:Vmn2r27 UTSW 6 124223912 missense probably benign 0.01
R0582:Vmn2r27 UTSW 6 124224290 missense probably benign 0.02
R0733:Vmn2r27 UTSW 6 124192188 missense probably benign 0.18
R0738:Vmn2r27 UTSW 6 124223702 missense possibly damaging 0.48
R0835:Vmn2r27 UTSW 6 124200624 missense probably damaging 0.99
R1183:Vmn2r27 UTSW 6 124200532 missense probably benign
R1401:Vmn2r27 UTSW 6 124191632 nonsense probably null
R1484:Vmn2r27 UTSW 6 124200515 missense probably damaging 0.96
R1536:Vmn2r27 UTSW 6 124200690 missense probably damaging 1.00
R1539:Vmn2r27 UTSW 6 124191771 missense probably damaging 1.00
R1565:Vmn2r27 UTSW 6 124231634 missense probably benign
R1595:Vmn2r27 UTSW 6 124231615 missense probably benign 0.00
R1614:Vmn2r27 UTSW 6 124223934 missense probably benign 0.01
R1742:Vmn2r27 UTSW 6 124200677 missense possibly damaging 0.48
R1816:Vmn2r27 UTSW 6 124230371 nonsense probably null
R1822:Vmn2r27 UTSW 6 124231634 missense probably benign
R1824:Vmn2r27 UTSW 6 124231634 missense probably benign
R1870:Vmn2r27 UTSW 6 124224211 missense probably benign 0.11
R1942:Vmn2r27 UTSW 6 124223763 missense probably damaging 1.00
R1962:Vmn2r27 UTSW 6 124223834 missense possibly damaging 0.70
R2069:Vmn2r27 UTSW 6 124224483 missense probably damaging 1.00
R2075:Vmn2r27 UTSW 6 124200551 missense possibly damaging 0.85
R2379:Vmn2r27 UTSW 6 124224383 missense possibly damaging 0.89
R3748:Vmn2r27 UTSW 6 124230392 missense probably benign 0.35
R4384:Vmn2r27 UTSW 6 124224156 missense probably benign 0.05
R4392:Vmn2r27 UTSW 6 124230176 missense probably benign 0.01
R4758:Vmn2r27 UTSW 6 124231637 missense possibly damaging 0.87
R5018:Vmn2r27 UTSW 6 124224182 missense probably benign 0.02
R5235:Vmn2r27 UTSW 6 124192054 missense probably damaging 0.99
R5718:Vmn2r27 UTSW 6 124192144 missense possibly damaging 0.66
R5859:Vmn2r27 UTSW 6 124200688 missense probably damaging 1.00
R5958:Vmn2r27 UTSW 6 124231727 missense probably benign 0.00
R6044:Vmn2r27 UTSW 6 124231772 missense probably benign
R6086:Vmn2r27 UTSW 6 124191999 missense probably damaging 1.00
R6396:Vmn2r27 UTSW 6 124224166 nonsense probably null
R6546:Vmn2r27 UTSW 6 124192410 missense possibly damaging 0.49
R6746:Vmn2r27 UTSW 6 124200593 missense possibly damaging 0.47
R6976:Vmn2r27 UTSW 6 124224353 nonsense probably null
R7091:Vmn2r27 UTSW 6 124223945 missense possibly damaging 0.85
R7145:Vmn2r27 UTSW 6 124191752 missense probably benign
R7176:Vmn2r27 UTSW 6 124192036 missense probably benign 0.01
R7382:Vmn2r27 UTSW 6 124197317 missense probably damaging 1.00
R7482:Vmn2r27 UTSW 6 124224261 missense probably damaging 1.00
R7853:Vmn2r27 UTSW 6 124192021 missense probably damaging 1.00
R7936:Vmn2r27 UTSW 6 124192021 missense probably damaging 1.00
R7942:Vmn2r27 UTSW 6 124224242 missense probably benign 0.00
R8266:Vmn2r27 UTSW 6 124191978 missense probably benign 0.00
Z1177:Vmn2r27 UTSW 6 124191901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAATTTCATCCATGTGATCTG -3'
(R):5'- ACTGCAGCTCTGTATCAGGG -3'

Sequencing Primer
(F):5'- CTCCACCAAAGTACTCATAAACTTG -3'
(R):5'- GCAGCTCTGTATCAGGGAATTATTC -3'
Posted On2019-12-20