Incidental Mutation 'R7859:BB014433'
ID607365
Institutional Source Beutler Lab
Gene Symbol BB014433
Ensembl Gene ENSMUSG00000049008
Gene Nameexpressed sequence BB014433
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7859 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location15041444-15046078 bp(-) (GRCm38)
Type of Mutationsmall deletion (14 aa in frame mutation)
DNA Base Change (assembly) GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG at 15042160 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050493] [ENSMUST00000123331] [ENSMUST00000179941]
Predicted Effect probably benign
Transcript: ENSMUST00000050493
Predicted Effect probably benign
Transcript: ENSMUST00000123331
SMART Domains Protein: ENSMUSP00000116138
Gene: ENSMUSG00000049008

DomainStartEndE-ValueType
internal_repeat_1 27 51 1.93e-5 PROSPERO
internal_repeat_2 31 59 5.9e-5 PROSPERO
internal_repeat_2 85 113 5.9e-5 PROSPERO
internal_repeat_1 95 117 1.93e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000179941
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in BB014433
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:BB014433 APN 8 15042510 missense probably benign 0.03
IGL01595:BB014433 APN 8 15042499 unclassified probably null
IGL02056:BB014433 APN 8 15042435 nonsense probably null
IGL02470:BB014433 APN 8 15042803 missense unknown
R0359:BB014433 UTSW 8 15042540 nonsense probably null
R1066:BB014433 UTSW 8 15042185 missense probably damaging 1.00
R1837:BB014433 UTSW 8 15042629 missense unknown
R1838:BB014433 UTSW 8 15042629 missense unknown
R2227:BB014433 UTSW 8 15041717 missense probably benign 0.34
R4508:BB014433 UTSW 8 15042095 missense possibly damaging 0.83
R4882:BB014433 UTSW 8 15042016 missense probably benign 0.05
R4996:BB014433 UTSW 8 15042166 missense probably benign 0.10
R5988:BB014433 UTSW 8 15041854 missense probably damaging 1.00
R6051:BB014433 UTSW 8 15042179 missense possibly damaging 0.83
R6483:BB014433 UTSW 8 15042208 missense probably benign 0.10
R6505:BB014433 UTSW 8 15042304 missense probably benign 0.10
R7237:BB014433 UTSW 8 15041765 missense probably benign 0.13
R7771:BB014433 UTSW 8 15042395 missense probably damaging 1.00
R7847:BB014433 UTSW 8 15042160 small deletion probably benign
X0066:BB014433 UTSW 8 15042833 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCACACAGCTTTGGAG -3'
(R):5'- GGTGTCTGCAACCCCAAAAC -3'

Sequencing Primer
(F):5'- CAGCTTTGGAGGTGTACACAC -3'
(R):5'- CCTAACTGAGGTGTCTGCAC -3'
Posted On2019-12-20