Incidental Mutation 'R7859:Nat2'
ID607366
Institutional Source Beutler Lab
Gene Symbol Nat2
Ensembl Gene ENSMUSG00000051147
Gene NameN-acetyltransferase 2 (arylamine N-acetyltransferase)
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location67494858-67502584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67501350 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 37 (F37L)
Ref Sequence ENSEMBL: ENSMUSP00000091181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093470] [ENSMUST00000163856]
Predicted Effect probably damaging
Transcript: ENSMUST00000093470
AA Change: F37L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091181
Gene: ENSMUSG00000051147
AA Change: F37L

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163856
AA Change: F37L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130065
Gene: ENSMUSG00000051147
AA Change: F37L

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.3e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Inactivation of this gene does not result in an overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Nat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Nat2 APN 8 67501541 missense probably damaging 1.00
IGL02341:Nat2 APN 8 67501718 missense possibly damaging 0.46
IGL03010:Nat2 APN 8 67502012 missense probably damaging 1.00
R0112:Nat2 UTSW 8 67501726 nonsense probably null
R0511:Nat2 UTSW 8 67501330 nonsense probably null
R0600:Nat2 UTSW 8 67501267 missense probably damaging 1.00
R0690:Nat2 UTSW 8 67501804 missense probably damaging 1.00
R1865:Nat2 UTSW 8 67501552 missense possibly damaging 0.61
R4118:Nat2 UTSW 8 67501619 missense possibly damaging 0.94
R5456:Nat2 UTSW 8 67501573 missense probably damaging 1.00
Z1176:Nat2 UTSW 8 67501264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGTTTTAACCACAGTCACCCC -3'
(R):5'- CACTGCTGTACTTATTGGCTGG -3'

Sequencing Primer
(F):5'- GTCACCCCAACCCAGTAAATTC -3'
(R):5'- CTGGAGTGTTAAAGACATATCCTCCC -3'
Posted On2019-12-20