Incidental Mutation 'R7859:Taar4'
ID607369
Institutional Source Beutler Lab
Gene Symbol Taar4
Ensembl Gene ENSMUSG00000069707
Gene Nametrace amine-associated receptor 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23960494-23961537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23961134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000090330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092660]
Predicted Effect probably benign
Transcript: ENSMUST00000092660
AA Change: V214A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090330
Gene: ENSMUSG00000069707
AA Change: V214A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 328 9.2e-11 PFAM
Pfam:7tm_1 50 313 4.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and aversion to PEA and puma urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Taar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Taar4 APN 10 23961011 missense probably damaging 1.00
IGL03202:Taar4 APN 10 23960794 missense probably damaging 1.00
I2288:Taar4 UTSW 10 23960920 missense probably benign 0.03
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0514:Taar4 UTSW 10 23960882 missense probably damaging 1.00
R1222:Taar4 UTSW 10 23961332 missense probably benign 0.05
R1248:Taar4 UTSW 10 23961038 missense possibly damaging 0.95
R1514:Taar4 UTSW 10 23960612 missense possibly damaging 0.71
R1921:Taar4 UTSW 10 23961341 missense probably damaging 1.00
R2074:Taar4 UTSW 10 23961173 missense probably benign 0.18
R2354:Taar4 UTSW 10 23961014 missense probably damaging 1.00
R2392:Taar4 UTSW 10 23961274 missense possibly damaging 0.94
R2698:Taar4 UTSW 10 23961430 missense probably damaging 1.00
R3902:Taar4 UTSW 10 23961015 missense probably damaging 1.00
R4688:Taar4 UTSW 10 23960833 missense probably damaging 1.00
R5495:Taar4 UTSW 10 23961283 missense possibly damaging 0.95
R5595:Taar4 UTSW 10 23960741 missense probably damaging 1.00
R5773:Taar4 UTSW 10 23961158 missense probably damaging 1.00
R7403:Taar4 UTSW 10 23961059 missense probably damaging 1.00
R7581:Taar4 UTSW 10 23961154 missense probably damaging 0.97
R7736:Taar4 UTSW 10 23960999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTCTTTCTACTCATCAGTTG -3'
(R):5'- AGGGTCTGTGATTGTCAAGAC -3'

Sequencing Primer
(F):5'- GGTCTTTCTACTCATCAGTTGGTCTG -3'
(R):5'- AGGGTAGCCAACACAACAC -3'
Posted On2019-12-20