Incidental Mutation 'R0195:Olfr272'
ID60737
Institutional Source Beutler Lab
Gene Symbol Olfr272
Ensembl Gene ENSMUSG00000051593
Gene Nameolfactory receptor 272
SynonymsGA_x6K02T2N78B-7084885-7085844, MOR262-7
MMRRC Submission 038454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location52910207-52919178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52910849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 315 (T315M)
Ref Sequence ENSEMBL: ENSMUSP00000149339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051600] [ENSMUST00000107667] [ENSMUST00000213989]
Predicted Effect probably benign
Transcript: ENSMUST00000051600
AA Change: T315M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055721
Gene: ENSMUSG00000051593
AA Change: T315M

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.6e-54 PFAM
Pfam:7tm_1 41 296 9.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107667
AA Change: T315M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103294
Gene: ENSMUSG00000051593
AA Change: T315M

DomainStartEndE-ValueType
Pfam:7tm_1 39 294 9.5e-33 PFAM
Pfam:7tm_4 138 287 3.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213989
AA Change: T315M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217085
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,512,974 R362P possibly damaging Het
Adam24 T A 8: 40,681,766 W758R probably benign Het
Adam26b G T 8: 43,520,270 T565K probably damaging Het
Adam7 T G 14: 68,527,627 probably benign Het
Adamts19 A G 18: 58,969,870 probably benign Het
Add1 A G 5: 34,610,646 probably benign Het
Ago1 A G 4: 126,463,691 C64R probably benign Het
Ankrd12 C T 17: 66,049,948 probably null Het
Arhgef33 A G 17: 80,381,434 K820E probably damaging Het
Arl9 T C 5: 77,006,494 V8A probably damaging Het
Aspm T C 1: 139,479,135 L1920P probably damaging Het
Atad2 A G 15: 58,099,954 probably benign Het
Atp2b2 A T 6: 113,793,874 V358E probably benign Het
C3ar1 A C 6: 122,851,155 C34W possibly damaging Het
C6 G A 15: 4,763,471 V353M probably benign Het
Capn7 T C 14: 31,365,581 I593T probably damaging Het
Casc3 T A 11: 98,821,493 D119E probably damaging Het
Ccna1 T A 3: 55,054,364 E45V probably damaging Het
Cdc37 A G 9: 21,142,280 V180A probably benign Het
Cdh23 A G 10: 60,317,059 I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 probably benign Het
Cngb3 A T 4: 19,280,975 M15L probably benign Het
Crygn A G 5: 24,756,038 M90T possibly damaging Het
Cse1l T A 2: 166,940,088 S661R probably benign Het
D830013O20Rik C T 12: 73,364,321 noncoding transcript Het
Ddx24 C T 12: 103,418,961 probably null Het
Dnah3 A T 7: 120,077,775 probably null Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dnttip2 A T 3: 122,276,161 T342S probably benign Het
Evx2 G T 2: 74,659,044 R125S probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Git1 T A 11: 77,501,073 D240E probably benign Het
Glp2r T A 11: 67,709,708 K438N probably damaging Het
Gm4778 A G 3: 94,265,922 Y79C possibly damaging Het
Hivep1 T A 13: 42,156,153 I623N probably benign Het
Il17re A G 6: 113,466,137 E312G probably damaging Het
Itgb7 G A 15: 102,222,183 probably benign Het
Itpr3 A G 17: 27,114,114 Y1900C probably damaging Het
Krt2 G A 15: 101,813,191 Q472* probably null Het
Krtap5-1 A C 7: 142,296,697 C125G unknown Het
Macf1 A G 4: 123,434,916 S2554P probably damaging Het
March10 C T 11: 105,385,525 G646R probably damaging Het
Mrpl48 A C 7: 100,546,353 probably benign Het
Myo16 A T 8: 10,315,538 probably benign Het
Nrcam A T 12: 44,584,845 E1060D probably benign Het
Nsd3 T A 8: 25,680,693 C731S probably damaging Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Nxnl2 G T 13: 51,171,447 R42L probably damaging Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Orc1 C T 4: 108,614,308 R786* probably null Het
P2ry6 A T 7: 100,938,697 W152R probably damaging Het
Pex5l T C 3: 32,992,953 N283D possibly damaging Het
Pgk2 T C 17: 40,207,731 I269V probably benign Het
Phgdh T G 3: 98,316,550 probably benign Het
Pzp A T 6: 128,487,478 L1362Q probably damaging Het
Rbbp9 T C 2: 144,548,106 probably benign Het
Rffl A G 11: 82,810,163 L244P probably damaging Het
Serpina11 T C 12: 103,985,872 Y213C probably damaging Het
Srsf11 A G 3: 158,036,535 probably benign Het
Sspo T A 6: 48,486,636 V3785E probably benign Het
Svep1 A T 4: 58,089,514 S1632T possibly damaging Het
Tm4sf1 T A 3: 57,293,059 D74V probably damaging Het
Tmprss15 T A 16: 79,034,334 T393S probably benign Het
Tnfaip3 A G 10: 19,005,713 L275P probably damaging Het
Trim30c A G 7: 104,382,429 V393A probably benign Het
Tssk2 T A 16: 17,899,575 S281T probably benign Het
Tubb4a A G 17: 57,081,499 S176P probably damaging Het
Unc45b T A 11: 82,937,828 M785K probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn1r176 G T 7: 23,835,585 Q48K probably benign Het
Vmn2r110 A T 17: 20,574,055 L784Q probably benign Het
Vps13b A G 15: 35,471,899 T783A probably benign Het
Zfp800 A G 6: 28,243,847 M373T probably damaging Het
Zmym1 A G 4: 127,047,911 F895L possibly damaging Het
Other mutations in Olfr272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr272 APN 4 52911618 missense possibly damaging 0.95
IGL02224:Olfr272 APN 4 52911392 missense probably damaging 0.97
IGL03293:Olfr272 APN 4 52910835 makesense probably null
K3955:Olfr272 UTSW 4 52911081 missense probably damaging 1.00
R0197:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0445:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R1517:Olfr272 UTSW 4 52911502 nonsense probably null
R1536:Olfr272 UTSW 4 52911260 missense probably benign 0.43
R1540:Olfr272 UTSW 4 52910996 missense probably benign 0.00
R1551:Olfr272 UTSW 4 52911397 nonsense probably null
R1612:Olfr272 UTSW 4 52911501 missense probably benign
R1920:Olfr272 UTSW 4 52910849 missense probably benign
R2181:Olfr272 UTSW 4 52911524 missense probably damaging 1.00
R5410:Olfr272 UTSW 4 52910991 missense probably benign 0.01
R6331:Olfr272 UTSW 4 52911399 missense probably damaging 1.00
R6336:Olfr272 UTSW 4 52911459 missense probably damaging 1.00
R7085:Olfr272 UTSW 4 52910961 missense probably benign 0.02
R7541:Olfr272 UTSW 4 52911376 missense probably benign 0.04
R7727:Olfr272 UTSW 4 52911368 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACAGATAAGACTCTGGGAATTCACACG -3'
(R):5'- CCATCTTCTCCATGTACGCAAAGCC -3'

Sequencing Primer
(F):5'- CCTATTAGCTTCTGAATGTCTAAGTG -3'
(R):5'- TGTACGCAAAGCCCAAGTC -3'
Posted On2013-07-24