Incidental Mutation 'R7859:Slc25a29'
ID607375
Institutional Source Beutler Lab
Gene Symbol Slc25a29
Ensembl Gene ENSMUSG00000021265
Gene Namesolute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
SynonymsCACL, mCACL, C030003J19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108825873-108835883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108826830 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 274 (T274I)
Ref Sequence ENSEMBL: ENSMUSP00000021693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021693]
Predicted Effect probably benign
Transcript: ENSMUST00000021693
AA Change: T274I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000021693
Gene: ENSMUSG00000021265
AA Change: T274I

DomainStartEndE-ValueType
Pfam:Mito_carr 1 91 1.5e-21 PFAM
Pfam:Mito_carr 88 182 4.6e-25 PFAM
Pfam:Mito_carr 185 279 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Slc25a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03287:Slc25a29 APN 12 108831209 missense possibly damaging 0.49
R0116:Slc25a29 UTSW 12 108827091 missense possibly damaging 0.94
R1876:Slc25a29 UTSW 12 108827711 missense probably damaging 0.98
R2094:Slc25a29 UTSW 12 108827432 missense probably damaging 1.00
R2233:Slc25a29 UTSW 12 108835661 missense possibly damaging 0.92
R2276:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2277:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2279:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2383:Slc25a29 UTSW 12 108827008 missense probably damaging 1.00
R4366:Slc25a29 UTSW 12 108831171 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCCATTTTACGGCTAAG -3'
(R):5'- TTAAGTCACGACTGCAAGCC -3'

Sequencing Primer
(F):5'- CCCCATTTTACGGCTAAGAAATAGGG -3'
(R):5'- CCGACGGGCTACAAGGAAC -3'
Posted On2019-12-20