Incidental Mutation 'R7859:Sema4d'
ID607380
Institutional Source Beutler Lab
Gene Symbol Sema4d
Ensembl Gene ENSMUSG00000021451
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
SynonymsSemacl2, coll-4, Semcl2, semaphorin H, CD100, Semaj, M-sema G
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location51685529-51793747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51722351 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 94 (K94N)
Ref Sequence ENSEMBL: ENSMUSP00000021900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021900] [ENSMUST00000110039] [ENSMUST00000110040]
Predicted Effect probably benign
Transcript: ENSMUST00000021900
AA Change: K94N

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021900
Gene: ENSMUSG00000021451
AA Change: K94N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110039
AA Change: K94N

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105666
Gene: ENSMUSG00000021451
AA Change: K94N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110040
AA Change: K94N

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105667
Gene: ENSMUSG00000021451
AA Change: K94N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display functional defects in their immune system but are normal in other systems of the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Sema4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Sema4d APN 13 51702937 intron probably null
IGL02155:Sema4d APN 13 51703267 missense probably benign 0.01
IGL02422:Sema4d APN 13 51703088 missense probably benign
IGL02795:Sema4d APN 13 51703411 missense probably benign 0.00
IGL03068:Sema4d APN 13 51708886 missense probably damaging 1.00
IGL03164:Sema4d APN 13 51708922 missense possibly damaging 0.58
R0060:Sema4d UTSW 13 51705257 unclassified probably benign
R0060:Sema4d UTSW 13 51705257 unclassified probably benign
R0305:Sema4d UTSW 13 51712728 missense probably damaging 1.00
R0309:Sema4d UTSW 13 51725311 missense probably benign 0.14
R0708:Sema4d UTSW 13 51712719 missense probably benign 0.17
R1809:Sema4d UTSW 13 51713691 critical splice donor site probably null
R1851:Sema4d UTSW 13 51711222 missense possibly damaging 0.94
R2096:Sema4d UTSW 13 51710001 missense probably damaging 1.00
R2159:Sema4d UTSW 13 51720535 missense probably damaging 1.00
R2367:Sema4d UTSW 13 51703140 intron probably benign
R4329:Sema4d UTSW 13 51703304 missense probably benign
R4372:Sema4d UTSW 13 51712731 missense probably damaging 1.00
R4384:Sema4d UTSW 13 51702883 missense probably damaging 1.00
R4590:Sema4d UTSW 13 51723618 missense probably benign 0.29
R4980:Sema4d UTSW 13 51711234 missense probably damaging 1.00
R5523:Sema4d UTSW 13 51711354 missense possibly damaging 0.89
R6086:Sema4d UTSW 13 51713745 missense probably damaging 1.00
R7197:Sema4d UTSW 13 51702836 missense probably benign 0.01
R7340:Sema4d UTSW 13 51723562 missense probably damaging 1.00
R7606:Sema4d UTSW 13 51723622 missense probably benign 0.00
R8193:Sema4d UTSW 13 51705156 nonsense probably null
Z1176:Sema4d UTSW 13 51703075 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACAGGCTTCTCCAGTGC -3'
(R):5'- CTGACTTTATTCTGGCTGCAAAC -3'

Sequencing Primer
(F):5'- AGCACCAATCCTGATGCTGGTAG -3'
(R):5'- CTGCAAACCAGTGAGCTTTG -3'
Posted On2019-12-20