Incidental Mutation 'R7859:Arsb'
ID607382
Institutional Source Beutler Lab
Gene Symbol Arsb
Ensembl Gene ENSMUSG00000042082
Gene Namearylsulfatase B
SynonymsAs-1r, As1-s, Ast-1, As-1s, Asr-1, 1110007C02Rik, As1, As1-r, As1-t, As-1, As-1t
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location93771630-93943016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93862107 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 308 (S308T)
Ref Sequence ENSEMBL: ENSMUSP00000088964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091403]
Predicted Effect probably benign
Transcript: ENSMUST00000091403
AA Change: S308T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000088964
Gene: ENSMUSG00000042082
AA Change: S308T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Sulfatase 46 364 1.7e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutation of this gene results in development of shortened limbs and snout and a broadened head after 4 weeks of age. Mutant animals have elevated concentrations of glucosaminoglycans in the urine and irregular cartilage structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Arsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Arsb APN 13 93790100 missense probably benign 0.07
IGL00334:Arsb APN 13 93939279 missense probably benign 0.01
IGL01560:Arsb APN 13 93807598 missense probably benign 0.01
IGL02408:Arsb APN 13 93794162 missense probably benign 0.19
IGL03396:Arsb APN 13 93939317 missense probably benign 0.01
dipper UTSW 13 93790066 missense possibly damaging 0.95
ouzel UTSW 13 93794220 critical splice donor site probably null
rivulet UTSW 13 93862327 missense probably damaging 1.00
R0145:Arsb UTSW 13 93862287 missense possibly damaging 0.60
R0379:Arsb UTSW 13 93940627 missense probably benign 0.20
R0488:Arsb UTSW 13 93940505 missense probably benign
R0560:Arsb UTSW 13 93790198 missense possibly damaging 0.66
R1938:Arsb UTSW 13 93862150 missense probably damaging 1.00
R1968:Arsb UTSW 13 93807559 missense probably benign 0.00
R2209:Arsb UTSW 13 93862101 missense probably benign 0.14
R2224:Arsb UTSW 13 93794171 missense probably damaging 1.00
R2520:Arsb UTSW 13 93940699 nonsense probably null
R4476:Arsb UTSW 13 93807595 missense probably damaging 1.00
R4910:Arsb UTSW 13 93771977 missense probably benign
R5153:Arsb UTSW 13 93940598 missense probably benign 0.20
R5185:Arsb UTSW 13 93794159 missense probably damaging 1.00
R5272:Arsb UTSW 13 93794162 missense possibly damaging 0.86
R5475:Arsb UTSW 13 93862265 missense probably benign 0.00
R5580:Arsb UTSW 13 93807545 missense probably damaging 1.00
R6371:Arsb UTSW 13 93790066 missense possibly damaging 0.95
R6668:Arsb UTSW 13 93794220 critical splice donor site probably null
R7084:Arsb UTSW 13 93940616 missense probably benign 0.00
R7735:Arsb UTSW 13 93771983 missense probably benign 0.00
R7801:Arsb UTSW 13 93862327 missense probably damaging 1.00
X0010:Arsb UTSW 13 93794202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCGTGGTTCTGTAAAGTCCTCTG -3'
(R):5'- AGCCATCCAGAGGTTTGGTTC -3'

Sequencing Primer
(F):5'- GAGCTCGTTCTCATCAAATGG -3'
(R):5'- CCATCCAGAGGTTTGGTTCCATTAG -3'
Posted On2019-12-20