Incidental Mutation 'R7859:Nrl'
ID607384
Institutional Source Beutler Lab
Gene Symbol Nrl
Ensembl Gene ENSMUSG00000040632
Gene Nameneural retina leucine zipper gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55518978-55524981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55522125 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 115 (S115L)
Ref Sequence ENSEMBL: ENSMUSP00000054457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000074225] [ENSMUST00000111404] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000171643] [ENSMUST00000178694] [ENSMUST00000228287] [ENSMUST00000228902]
Predicted Effect probably benign
Transcript: ENSMUST00000062232
AA Change: S115L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632
AA Change: S115L

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074225
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111404
AA Change: S115L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632
AA Change: S115L

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163767
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165262
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171643
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178694
AA Change: S115L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632
AA Change: S115L

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228287
AA Change: S115L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228902
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the basic leucine zipper domain family of transcription factors. The encoded protein is preferentially expressed in the retina and is necessary for rod photoreceptor development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a retinal defect causing loss of rod function, exaggerated cone function, short, sparse outer segments, and abnormal disks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Nrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Nrl APN 14 55522110 missense probably benign 0.00
R1940:Nrl UTSW 14 55522435 missense probably damaging 1.00
R2144:Nrl UTSW 14 55520850 missense possibly damaging 0.50
R2311:Nrl UTSW 14 55522452 missense probably damaging 1.00
R4424:Nrl UTSW 14 55522218 missense probably benign 0.04
R5706:Nrl UTSW 14 55522432 missense probably damaging 1.00
R7942:Nrl UTSW 14 55522125 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAAGGCGATCTAGTTTCTCTG -3'
(R):5'- CCAGTCCCTTGGCTATGGAATATG -3'

Sequencing Primer
(F):5'- GATTTTTCTCAAGGACCTTGTTCTG -3'
(R):5'- TTCAGTGAGCCAGGCATG -3'
Posted On2019-12-20