Incidental Mutation 'R7859:Slc22a22'
ID607385
Institutional Source Beutler Lab
Gene Symbol Slc22a22
Ensembl Gene ENSMUSG00000022366
Gene Namesolute carrier family 22 (organic cation transporter), member 22
SynonymsBC026439, OAT-PG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location57243767-57477625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57250952 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 326 (D326E)
Ref Sequence ENSEMBL: ENSMUSP00000022995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022995] [ENSMUST00000110196]
Predicted Effect probably benign
Transcript: ENSMUST00000022995
AA Change: D326E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022995
Gene: ENSMUSG00000022366
AA Change: D326E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 117 483 1.2e-26 PFAM
Pfam:Sugar_tr 144 447 1.3e-20 PFAM
Pfam:Sugar_tr 393 553 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110196
AA Change: D326E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105825
Gene: ENSMUSG00000022366
AA Change: D326E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 116 483 1.4e-26 PFAM
Pfam:Sugar_tr 145 426 1e-19 PFAM
Pfam:Sugar_tr 391 553 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Slc22a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Slc22a22 APN 15 57254278 missense probably damaging 1.00
IGL01140:Slc22a22 APN 15 57263338 missense probably damaging 1.00
IGL02350:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL02357:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL03115:Slc22a22 APN 15 57263274 missense probably damaging 1.00
IGL03244:Slc22a22 APN 15 57249552 splice site probably benign
IGL03384:Slc22a22 APN 15 57254216 missense probably benign 0.01
R0371:Slc22a22 UTSW 15 57249735 missense possibly damaging 0.82
R0501:Slc22a22 UTSW 15 57249650 missense probably benign 0.16
R0684:Slc22a22 UTSW 15 57263362 missense probably benign 0.04
R0722:Slc22a22 UTSW 15 57256553 unclassified probably null
R1240:Slc22a22 UTSW 15 57250872 missense probably benign 0.02
R1472:Slc22a22 UTSW 15 57247520 missense probably benign 0.03
R2040:Slc22a22 UTSW 15 57247540 nonsense probably null
R2125:Slc22a22 UTSW 15 57254240 missense probably damaging 1.00
R3707:Slc22a22 UTSW 15 57250973 missense probably damaging 1.00
R3921:Slc22a22 UTSW 15 57256544 missense probably benign 0.07
R4184:Slc22a22 UTSW 15 57256566 nonsense probably null
R4561:Slc22a22 UTSW 15 57263385 missense probably damaging 1.00
R4626:Slc22a22 UTSW 15 57263338 missense probably damaging 1.00
R4887:Slc22a22 UTSW 15 57249752 missense probably benign 0.20
R5181:Slc22a22 UTSW 15 57255123 missense probably benign 0.08
R5486:Slc22a22 UTSW 15 57263451 missense probably damaging 0.97
R5621:Slc22a22 UTSW 15 57259151 missense probably benign 0.02
R5812:Slc22a22 UTSW 15 57256473 critical splice donor site probably null
R5958:Slc22a22 UTSW 15 57263536 missense possibly damaging 0.95
R6517:Slc22a22 UTSW 15 57250969 missense probably benign 0.28
R6555:Slc22a22 UTSW 15 57259131 missense probably benign 0.08
R6724:Slc22a22 UTSW 15 57247532 missense probably damaging 1.00
R6744:Slc22a22 UTSW 15 57254272 missense possibly damaging 0.46
R7078:Slc22a22 UTSW 15 57263480 missense probably benign 0.01
R7085:Slc22a22 UTSW 15 57249649 missense probably benign 0.00
R7263:Slc22a22 UTSW 15 57249711 missense probably benign
R7335:Slc22a22 UTSW 15 57263375 missense probably benign 0.19
R7871:Slc22a22 UTSW 15 57263355 missense possibly damaging 0.86
R8297:Slc22a22 UTSW 15 57259110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCCTCGAAGGGCTTAG -3'
(R):5'- TGACCTTGTCAGATTAGTGTGC -3'

Sequencing Primer
(F):5'- CTCGAAGGGCTTAGCACGATG -3'
(R):5'- ATGGGAGTCAGTTCTAGACTTACC -3'
Posted On2019-12-20