Incidental Mutation 'R7859:Crkl'
ID607387
Institutional Source Beutler Lab
Gene Symbol Crkl
Ensembl Gene ENSMUSG00000006134
Gene Namev-crk avian sarcoma virus CT10 oncogene homolog-like
Synonyms1110025F07Rik, Crkol
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17451987-17487434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17469096 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 172 (M172K)
Ref Sequence ENSEMBL: ENSMUSP00000006293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006293] [ENSMUST00000231228] [ENSMUST00000231629]
Predicted Effect probably damaging
Transcript: ENSMUST00000006293
AA Change: M172K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006293
Gene: ENSMUSG00000006134
AA Change: M172K

DomainStartEndE-ValueType
SH2 12 94 1.49e-26 SMART
SH3 126 182 3.4e-19 SMART
SH3 238 295 2.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231228
Predicted Effect probably benign
Transcript: ENSMUST00000231629
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In certain mouse genetic backgrounds this protein is essential for embryonic development. It is important for neural crest cell differentiation and survival and is proposed to play an important role in transducing the oncogenic signal of Bcr/Abl. Deletion of this gene in mouse mimics the phenotype of DiGeorge/velocardiofacial syndrome in human. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit fetal lethality with abnormal heart, craniofacial, and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Olfr1448 T A 19: 12,919,982 E109V probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Crkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Crkl APN 16 17469234 missense probably benign 0.07
I2288:Crkl UTSW 16 17483748 missense probably damaging 1.00
R1545:Crkl UTSW 16 17483692 missense probably damaging 1.00
R6030:Crkl UTSW 16 17452740 missense probably damaging 1.00
R6030:Crkl UTSW 16 17452740 missense probably damaging 1.00
R6788:Crkl UTSW 16 17483781 missense probably damaging 0.98
R7649:Crkl UTSW 16 17452502 missense unknown
R7942:Crkl UTSW 16 17469096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTAAGGTACCCAAGCCC -3'
(R):5'- CATTCTGTGTGGATGGCAAAG -3'

Sequencing Primer
(F):5'- CAGTGGGTTCTGTCTCAGCAC -3'
(R):5'- AAAGGGTTGATCGCTGCC -3'
Posted On2019-12-20