Mutagenetix > Incidental Mutations

Incidental Mutation 'R7859:Vmn2r109'

607389

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R7859 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20541174 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 640 (F640L)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

Predicted Effect

probably damaging
Transcript: ENSMUST00000167093
AA Change: F640L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: F640L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,384,526	L564P	probably damaging	Het
Arsb	T	A	13: 93,862,107	S308T	probably benign	Het
Atxn10	A	G	15: 85,462,325	D428G	probably benign	Het
BB014433	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	8: 15,042,160		probably benign	Het
Cd300a	T	C	11: 114,893,339	Y58H	probably benign	Het
Crkl	T	A	16: 17,469,096	M172K	probably damaging	Het
Cyfip1	T	C	7: 55,900,026	I647T	probably damaging	Het
Dlgap1	A	G	17: 70,516,688	T223A	probably benign	Het
Dmtf1	T	C	5: 9,128,044	S372G	probably damaging	Het
Dock8	G	A	19: 25,183,570	V1814M	probably damaging	Het
Dusp22	A	C	13: 30,708,754	K171N	probably benign	Het
Evi2a	T	C	11: 79,527,626	S53G	probably benign	Het
Ipcef1	T	A	10: 6,890,569	D376V	probably damaging	Het
Kndc1	A	T	7: 139,920,964	D723V	possibly damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Mcur1	G	A	13: 43,560,009	R40*	probably null	Het
Mgam	T	A	6: 40,740,179	N265K	possibly damaging	Het
Muc6	G	A	7: 141,645,420	T1069I	probably damaging	Het
Myh2	T	C	11: 67,186,700	L887P	probably damaging	Het
Myo1d	T	G	11: 80,684,377	D171A	probably damaging	Het
Nat2	T	A	8: 67,501,350	F37L	probably damaging	Het
Nkx2-2	A	G	2: 147,177,810	C236R	unknown	Het
Nrl	G	A	14: 55,522,125	S115L	probably benign	Het
Nrsn1	A	C	13: 25,262,271	S41A	probably damaging	Het
Olfr1448	T	A	19: 12,919,982	E109V	probably damaging	Het
Pax8	T	A	2: 24,421,555	H456L	possibly damaging	Het
Pkd1	T	A	17: 24,571,280	I979K	probably damaging	Het
Prex2	A	G	1: 11,080,050	N149D	probably damaging	Het
Psg28	A	T	7: 18,426,224	V349D	probably damaging	Het
Ptpro	G	A	6: 137,392,807		probably null	Het
Sema4d	T	A	13: 51,722,351	K94N	probably benign	Het
Slc22a22	A	T	15: 57,250,952	D326E	probably benign	Het
Slc25a29	G	A	12: 108,826,830	T274I	probably benign	Het
Slc43a1	T	C	2: 84,856,876	F374L	possibly damaging	Het
Syne1	G	T	10: 5,157,683	Q520K	possibly damaging	Het
Taar4	T	C	10: 23,961,134	V214A	probably benign	Het
Tex22	T	A	12: 113,088,483	C54S	possibly damaging	Het
Tmem2	T	A	19: 21,832,175	I973N	possibly damaging	Het
Tpo	T	A	12: 30,100,574	I436F	probably damaging	Het
Usp53	T	C	3: 122,949,766	H507R	possibly damaging	Het
Usp54	T	C	14: 20,588,136	E255G	probably benign	Het
Vmn2r124	A	G	17: 18,061,950	Y80C	probably damaging	Het
Vmn2r27	A	T	6: 124,224,242	I252K	probably benign	Het
Zfp457	A	G	13: 67,306,381		probably benign	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R7942:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7954:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTGCCATCCATATTCCACAAAG -3'
(R):5'- TGTCCTACAAAGACCCGTTGG -3'

Sequencing Primer
(F):5'- CCATATTCCACAAAGAAGAAGTTGG -3'
(R):5'- GGGGTGACACTAGCCAACATATC -3'

Posted On

2019-12-20