Mutagenetix > Incidental Mutations

Incidental Mutation 'R7859:Vmn2r109'

607389

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R7859 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20541174 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 640 (F640L)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

Predicted Effect

probably damaging
Transcript: ENSMUST00000167093
AA Change: F640L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: F640L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,384,526	L564P	probably damaging	Het
Arsb	T	A	13: 93,862,107	S308T	probably benign	Het
Atxn10	A	G	15: 85,462,325	D428G	probably benign	Het
BB014433	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	8: 15,042,160		probably benign	Het
Cd300a	T	C	11: 114,893,339	Y58H	probably benign	Het
Crkl	T	A	16: 17,469,096	M172K	probably damaging	Het
Cyfip1	T	C	7: 55,900,026	I647T	probably damaging	Het
Dlgap1	A	G	17: 70,516,688	T223A	probably benign	Het
Dmtf1	T	C	5: 9,128,044	S372G	probably damaging	Het
Dock8	G	A	19: 25,183,570	V1814M	probably damaging	Het
Dusp22	A	C	13: 30,708,754	K171N	probably benign	Het
Evi2a	T	C	11: 79,527,626	S53G	probably benign	Het
Ipcef1	T	A	10: 6,890,569	D376V	probably damaging	Het
Kndc1	A	T	7: 139,920,964	D723V	possibly damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Mcur1	G	A	13: 43,560,009	R40*	probably null	Het
Mgam	T	A	6: 40,740,179	N265K	possibly damaging	Het
Muc6	G	A	7: 141,645,420	T1069I	probably damaging	Het
Myh2	T	C	11: 67,186,700	L887P	probably damaging	Het
Myo1d	T	G	11: 80,684,377	D171A	probably damaging	Het
Nat2	T	A	8: 67,501,350	F37L	probably damaging	Het
Nkx2-2	A	G	2: 147,177,810	C236R	unknown	Het
Nrl	G	A	14: 55,522,125	S115L	probably benign	Het
Nrsn1	A	C	13: 25,262,271	S41A	probably damaging	Het
Olfr1448	T	A	19: 12,919,982	E109V	probably damaging	Het
Pax8	T	A	2: 24,421,555	H456L	possibly damaging	Het
Pkd1	T	A	17: 24,571,280	I979K	probably damaging	Het
Prex2	A	G	1: 11,080,050	N149D	probably damaging	Het
Psg28	A	T	7: 18,426,224	V349D	probably damaging	Het
Ptpro	G	A	6: 137,392,807		probably null	Het
Sema4d	T	A	13: 51,722,351	K94N	probably benign	Het
Slc22a22	A	T	15: 57,250,952	D326E	probably benign	Het
Slc25a29	G	A	12: 108,826,830	T274I	probably benign	Het
Slc43a1	T	C	2: 84,856,876	F374L	possibly damaging	Het
Syne1	G	T	10: 5,157,683	Q520K	possibly damaging	Het
Taar4	T	C	10: 23,961,134	V214A	probably benign	Het
Tex22	T	A	12: 113,088,483	C54S	possibly damaging	Het
Tmem2	T	A	19: 21,832,175	I973N	possibly damaging	Het
Tpo	T	A	12: 30,100,574	I436F	probably damaging	Het
Usp53	T	C	3: 122,949,766	H507R	possibly damaging	Het
Usp54	T	C	14: 20,588,136	E255G	probably benign	Het
Vmn2r124	A	G	17: 18,061,950	Y80C	probably damaging	Het
Vmn2r27	A	T	6: 124,224,242	I252K	probably benign	Het
Zfp457	A	G	13: 67,306,381		probably benign	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTGCCATCCATATTCCACAAAG -3'
(R):5'- TGTCCTACAAAGACCCGTTGG -3'

Sequencing Primer
(F):5'- CCATATTCCACAAAGAAGAAGTTGG -3'
(R):5'- GGGGTGACACTAGCCAACATATC -3'

Posted On

2019-12-20