Incidental Mutation 'R7859:Olfr1448'
ID607393
Institutional Source Beutler Lab
Gene Symbol Olfr1448
Ensembl Gene ENSMUSG00000048456
Gene Nameolfactory receptor 1448
SynonymsMOR202-5, GA_x6K02T2RE5P-3249780-3248836
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7859 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12916661-12924419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12919982 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 109 (E109V)
Ref Sequence ENSEMBL: ENSMUSP00000149191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054737] [ENSMUST00000213177] [ENSMUST00000213713] [ENSMUST00000216888]
Predicted Effect probably damaging
Transcript: ENSMUST00000054737
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055664
Gene: ENSMUSG00000048456
AA Change: E109V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.2e-54 PFAM
Pfam:7tm_1 39 288 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213177
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213713
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216888
AA Change: E109V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,526 L564P probably damaging Het
Arsb T A 13: 93,862,107 S308T probably benign Het
Atxn10 A G 15: 85,462,325 D428G probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cd300a T C 11: 114,893,339 Y58H probably benign Het
Crkl T A 16: 17,469,096 M172K probably damaging Het
Cyfip1 T C 7: 55,900,026 I647T probably damaging Het
Dlgap1 A G 17: 70,516,688 T223A probably benign Het
Dmtf1 T C 5: 9,128,044 S372G probably damaging Het
Dock8 G A 19: 25,183,570 V1814M probably damaging Het
Dusp22 A C 13: 30,708,754 K171N probably benign Het
Evi2a T C 11: 79,527,626 S53G probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kndc1 A T 7: 139,920,964 D723V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mcur1 G A 13: 43,560,009 R40* probably null Het
Mgam T A 6: 40,740,179 N265K possibly damaging Het
Muc6 G A 7: 141,645,420 T1069I probably damaging Het
Myh2 T C 11: 67,186,700 L887P probably damaging Het
Myo1d T G 11: 80,684,377 D171A probably damaging Het
Nat2 T A 8: 67,501,350 F37L probably damaging Het
Nkx2-2 A G 2: 147,177,810 C236R unknown Het
Nrl G A 14: 55,522,125 S115L probably benign Het
Nrsn1 A C 13: 25,262,271 S41A probably damaging Het
Pax8 T A 2: 24,421,555 H456L possibly damaging Het
Pkd1 T A 17: 24,571,280 I979K probably damaging Het
Prex2 A G 1: 11,080,050 N149D probably damaging Het
Psg28 A T 7: 18,426,224 V349D probably damaging Het
Ptpro G A 6: 137,392,807 probably null Het
Sema4d T A 13: 51,722,351 K94N probably benign Het
Slc22a22 A T 15: 57,250,952 D326E probably benign Het
Slc25a29 G A 12: 108,826,830 T274I probably benign Het
Slc43a1 T C 2: 84,856,876 F374L possibly damaging Het
Syne1 G T 10: 5,157,683 Q520K possibly damaging Het
Taar4 T C 10: 23,961,134 V214A probably benign Het
Tex22 T A 12: 113,088,483 C54S possibly damaging Het
Tmem2 T A 19: 21,832,175 I973N possibly damaging Het
Tpo T A 12: 30,100,574 I436F probably damaging Het
Usp53 T C 3: 122,949,766 H507R possibly damaging Het
Usp54 T C 14: 20,588,136 E255G probably benign Het
Vmn2r109 G T 17: 20,541,174 F640L probably damaging Het
Vmn2r124 A G 17: 18,061,950 Y80C probably damaging Het
Vmn2r27 A T 6: 124,224,242 I252K probably benign Het
Zfp457 A G 13: 67,306,381 probably benign Het
Other mutations in Olfr1448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1448 APN 19 12920126 missense probably damaging 1.00
IGL01730:Olfr1448 APN 19 12919562 missense probably damaging 1.00
IGL01901:Olfr1448 APN 19 12919583 missense probably damaging 0.98
IGL02055:Olfr1448 APN 19 12919566 missense possibly damaging 0.78
R0152:Olfr1448 UTSW 19 12920108 missense possibly damaging 0.49
R0311:Olfr1448 UTSW 19 12920096 missense possibly damaging 0.91
R0349:Olfr1448 UTSW 19 12919935 missense probably damaging 1.00
R1873:Olfr1448 UTSW 19 12919488 missense probably damaging 1.00
R2371:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R3548:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R4697:Olfr1448 UTSW 19 12919934 missense probably damaging 0.99
R5482:Olfr1448 UTSW 19 12919905 missense probably damaging 0.96
R5748:Olfr1448 UTSW 19 12920015 missense probably damaging 1.00
R5749:Olfr1448 UTSW 19 12920225 missense probably benign 0.02
R5795:Olfr1448 UTSW 19 12919824 missense possibly damaging 0.95
R5952:Olfr1448 UTSW 19 12919830 missense probably benign 0.00
R6228:Olfr1448 UTSW 19 12919937 missense probably damaging 1.00
R6273:Olfr1448 UTSW 19 12919400 missense probably benign 0.02
R6341:Olfr1448 UTSW 19 12919479 missense probably benign 0.29
R6343:Olfr1448 UTSW 19 12919582 missense probably damaging 1.00
R6454:Olfr1448 UTSW 19 12920031 missense probably benign 0.10
R7666:Olfr1448 UTSW 19 12920162 missense probably damaging 0.99
R7810:Olfr1448 UTSW 19 12919865 missense probably benign 0.01
R7869:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
R7942:Olfr1448 UTSW 19 12919982 missense probably damaging 1.00
R7952:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGGTGTCTGAGCACGATAGG -3'
(R):5'- TGCTGGACTCACATCTCCAC -3'

Sequencing Primer
(F):5'- GTGGTCTATCACATTGAACTTGCAG -3'
(R):5'- TGGACTCACATCTCCACACTCC -3'
Posted On2019-12-20