Incidental Mutation 'R7860:Pla2g4d'
ID 607404
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission 045913-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7860 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120097211 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 796 (V796A)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably benign
Transcript: ENSMUST00000094665
AA Change: V796A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: V796A

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,905,707 (GRCm39) T493A probably damaging Het
Aars1 A G 8: 111,776,493 (GRCm39) K650E probably benign Het
Abcb1b C T 5: 8,882,258 (GRCm39) S793F probably benign Het
Adamts18 T A 8: 114,501,908 (GRCm39) I318F probably damaging Het
Adcy8 A G 15: 64,571,322 (GRCm39) I1137T probably damaging Het
Ambra1 T A 2: 91,603,838 (GRCm39) F607L probably benign Het
Ankrd46 A T 15: 36,479,566 (GRCm39) V175D possibly damaging Het
Arhgap28 C A 17: 68,208,277 (GRCm39) E114* probably null Het
Arrdc1 C T 2: 24,816,158 (GRCm39) G282S probably damaging Het
Atp1a3 A T 7: 24,681,216 (GRCm39) L790Q probably damaging Het
Bend5 T A 4: 111,272,406 (GRCm39) V12D probably damaging Het
Bod1l C T 5: 41,976,608 (GRCm39) E1569K probably damaging Het
Cdc123 T A 2: 5,808,775 (GRCm39) I234L probably benign Het
Cep126 T G 9: 8,120,749 (GRCm39) E91D probably damaging Het
Cep89 T A 7: 35,113,570 (GRCm39) D199E possibly damaging Het
Ces1d T C 8: 93,897,765 (GRCm39) T442A probably benign Het
Chsy3 C T 18: 59,542,299 (GRCm39) A479V probably benign Het
Clcn4 C A 7: 7,296,060 (GRCm39) G261C probably damaging Het
Clhc1 A T 11: 29,507,651 (GRCm39) probably null Het
Cnot3 T A 7: 3,658,565 (GRCm39) probably null Het
Col9a1 C A 1: 24,276,261 (GRCm39) P723H probably damaging Het
Crybg3 A T 16: 59,375,605 (GRCm39) M169K probably benign Het
Cxxc4 A G 3: 133,963,814 (GRCm39) R353G probably benign Het
Dennd3 A T 15: 73,412,657 (GRCm39) I440F probably damaging Het
Dnai3 A G 3: 145,772,675 (GRCm39) L457P probably damaging Het
Elmo3 G T 8: 106,035,649 (GRCm39) S553I probably damaging Het
Elovl2 A G 13: 41,340,943 (GRCm39) Y198H probably benign Het
Epm2aip1 A G 9: 111,101,105 (GRCm39) Y26C probably damaging Het
Ext1 A C 15: 52,953,335 (GRCm39) C510G possibly damaging Het
Extl3 A T 14: 65,314,938 (GRCm39) D81E probably benign Het
Fbxl5 T A 5: 43,916,018 (GRCm39) T465S probably benign Het
Fbxo31 G A 8: 122,291,384 (GRCm39) probably null Het
Gabrr2 A T 4: 33,081,470 (GRCm39) K169* probably null Het
Haus4 A G 14: 54,779,602 (GRCm39) Y341H probably damaging Het
Itgae A T 11: 73,011,099 (GRCm39) probably null Het
Jmjd7 C T 2: 119,860,996 (GRCm39) H149Y possibly damaging Het
Kcnh2 C T 5: 24,529,561 (GRCm39) C725Y probably damaging Het
Mroh1 C T 15: 76,331,532 (GRCm39) P1252L probably benign Het
Ms4a14 A G 19: 11,280,308 (GRCm39) F750S probably benign Het
Naf1 T A 8: 67,313,165 (GRCm39) D49E unknown Het
Notch3 T C 17: 32,341,747 (GRCm39) T2002A possibly damaging Het
Or10q12 T A 19: 13,745,716 (GRCm39) D3E probably benign Het
Or14c44 A G 7: 86,057,119 (GRCm39) probably benign Het
Or1e33 A T 11: 73,738,333 (GRCm39) I206N probably benign Het
Or2d3c A T 7: 106,525,777 (GRCm39) D296E probably benign Het
Or2l13b A T 16: 19,349,167 (GRCm39) C168S probably damaging Het
Or7e175 A T 9: 20,048,871 (GRCm39) N153I probably benign Het
Or9s23 G A 1: 92,501,810 (GRCm39) D306N probably benign Het
Pck1 A G 2: 172,997,743 (GRCm39) T271A possibly damaging Het
Penk A G 4: 4,133,976 (GRCm39) W224R possibly damaging Het
Per2 C A 1: 91,372,481 (GRCm39) V198F probably damaging Het
Phf11d A G 14: 59,599,280 (GRCm39) M23T probably damaging Het
Pramel51 A T 12: 88,143,122 (GRCm39) N360K possibly damaging Het
Prdx6 A T 1: 161,069,428 (GRCm39) probably null Het
Prep A T 10: 44,967,108 (GRCm39) N47I probably damaging Het
Prodh2 A T 7: 30,212,064 (GRCm39) probably null Het
Prss38 G T 11: 59,265,996 (GRCm39) H96N probably damaging Het
Rab11a C A 9: 64,635,613 (GRCm39) E47* probably null Het
Rad18 C T 6: 112,626,798 (GRCm39) G369D probably benign Het
Rragc T C 4: 123,823,717 (GRCm39) V330A probably damaging Het
Serpina9 A T 12: 103,967,680 (GRCm39) H238Q probably benign Het
Serpinb3b T A 1: 107,085,467 (GRCm39) K91N probably damaging Het
Slc16a12 T G 19: 34,652,730 (GRCm39) S139R probably benign Het
Slc22a27 T A 19: 7,887,472 (GRCm39) probably null Het
Slc25a11 A G 11: 70,536,005 (GRCm39) V243A probably benign Het
Slc38a9 A T 13: 112,868,148 (GRCm39) I545F probably benign Het
Slc39a8 A T 3: 135,590,157 (GRCm39) H349L probably damaging Het
Slk C T 19: 47,630,510 (GRCm39) T1227I possibly damaging Het
Spdye4b A G 5: 143,180,609 (GRCm39) E25G possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
St3gal1 A G 15: 66,983,114 (GRCm39) V214A probably benign Het
St7l T A 3: 104,833,893 (GRCm39) M550K probably benign Het
Tbk1 A C 10: 121,388,151 (GRCm39) F638C possibly damaging Het
Tex101 A T 7: 24,369,190 (GRCm39) C114S probably damaging Het
Ttll13 A G 7: 79,905,135 (GRCm39) M384V probably benign Het
Ugt2b37 A T 5: 87,402,189 (GRCm39) D147E probably damaging Het
Vmn1r10 A T 6: 57,090,686 (GRCm39) T93S probably benign Het
Wasl G A 6: 24,619,396 (GRCm39) P375S unknown Het
Zfp236 C A 18: 82,692,481 (GRCm39) E165* probably null Het
Zfp839 A T 12: 110,822,060 (GRCm39) R291S probably damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120,114,644 (GRCm39) missense probably benign
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120,100,045 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7692:Pla2g4d UTSW 2 120,109,776 (GRCm39) missense possibly damaging 0.84
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8737:Pla2g4d UTSW 2 120,100,466 (GRCm39) missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGCAGGCTGAGTTAAGC -3'
(R):5'- TTTCTGGCTGGAGGGAAAAG -3'

Sequencing Primer
(F):5'- GCTGAGTTAAGCCCTTGGAAG -3'
(R):5'- TGAGTGACAGTCTTGCACAC -3'
Posted On 2019-12-20