Incidental Mutation 'R7860:Zfp236'
ID607467
Institutional Source Beutler Lab
Gene Symbol Zfp236
Ensembl Gene ENSMUSG00000041258
Gene Namezinc finger protein 236
SynonymsLOC240456
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7860 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location82593593-82692883 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 82674356 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 165 (E165*)
Ref Sequence ENSEMBL: ENSMUSP00000138557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171071] [ENSMUST00000182122] [ENSMUST00000183048]
Predicted Effect probably null
Transcript: ENSMUST00000171071
AA Change: E165*
SMART Domains Protein: ENSMUSP00000130004
Gene: ENSMUSG00000041258
AA Change: E165*

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
low complexity region 290 309 N/A INTRINSIC
low complexity region 403 426 N/A INTRINSIC
ZnF_C2H2 436 458 1.98e-4 SMART
ZnF_C2H2 464 486 9.58e-3 SMART
ZnF_C2H2 492 514 6.42e-4 SMART
ZnF_C2H2 520 542 1.18e-2 SMART
low complexity region 592 605 N/A INTRINSIC
ZnF_C2H2 611 633 1.62e0 SMART
ZnF_C2H2 639 661 5.21e-4 SMART
ZnF_C2H2 667 689 6.78e-3 SMART
ZnF_C2H2 695 717 7.37e-4 SMART
low complexity region 720 733 N/A INTRINSIC
ZnF_C2H2 922 944 5.21e-4 SMART
ZnF_C2H2 950 972 1.04e-3 SMART
ZnF_C2H2 978 1000 8.6e-5 SMART
ZnF_C2H2 1006 1028 2.75e-3 SMART
low complexity region 1030 1039 N/A INTRINSIC
ZnF_C2H2 1122 1144 7.78e-3 SMART
ZnF_C2H2 1150 1172 3.63e-3 SMART
ZnF_C2H2 1178 1200 6.88e-4 SMART
ZnF_C2H2 1206 1228 5.42e-2 SMART
low complexity region 1243 1258 N/A INTRINSIC
low complexity region 1462 1477 N/A INTRINSIC
ZnF_C2H2 1612 1635 7.15e-2 SMART
ZnF_C2H2 1641 1663 2.91e-2 SMART
ZnF_C2H2 1677 1699 7.26e-3 SMART
ZnF_C2H2 1705 1727 1.84e-4 SMART
ZnF_C2H2 1733 1756 2.95e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182122
AA Change: E165*
SMART Domains Protein: ENSMUSP00000138557
Gene: ENSMUSG00000041258
AA Change: E165*

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
ZnF_C2H2 484 506 1.98e-4 SMART
ZnF_C2H2 512 534 9.58e-3 SMART
ZnF_C2H2 540 562 6.42e-4 SMART
ZnF_C2H2 568 590 1.18e-2 SMART
low complexity region 640 653 N/A INTRINSIC
ZnF_C2H2 659 681 1.62e0 SMART
ZnF_C2H2 687 709 5.21e-4 SMART
ZnF_C2H2 715 737 6.78e-3 SMART
ZnF_C2H2 743 765 7.37e-4 SMART
low complexity region 768 781 N/A INTRINSIC
ZnF_C2H2 970 992 5.21e-4 SMART
ZnF_C2H2 998 1020 1.04e-3 SMART
ZnF_C2H2 1026 1048 8.6e-5 SMART
ZnF_C2H2 1054 1076 2.75e-3 SMART
low complexity region 1078 1087 N/A INTRINSIC
ZnF_C2H2 1170 1192 7.78e-3 SMART
ZnF_C2H2 1198 1220 3.63e-3 SMART
ZnF_C2H2 1226 1248 6.88e-4 SMART
ZnF_C2H2 1254 1276 5.42e-2 SMART
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1510 1525 N/A INTRINSIC
ZnF_C2H2 1660 1683 7.15e-2 SMART
ZnF_C2H2 1689 1711 2.91e-2 SMART
ZnF_C2H2 1725 1747 7.26e-3 SMART
ZnF_C2H2 1753 1775 1.84e-4 SMART
ZnF_C2H2 1781 1804 2.95e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183048
AA Change: E165*
SMART Domains Protein: ENSMUSP00000138179
Gene: ENSMUSG00000041258
AA Change: E165*

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,928,726 T493A probably damaging Het
Aars A G 8: 111,049,861 K650E probably benign Het
Abcb1b C T 5: 8,832,258 S793F probably benign Het
Adamts18 T A 8: 113,775,276 I318F probably damaging Het
Adcy8 A G 15: 64,699,473 I1137T probably damaging Het
Ambra1 T A 2: 91,773,493 F607L probably benign Het
Ankrd46 A T 15: 36,479,420 V175D possibly damaging Het
Arhgap28 C A 17: 67,901,282 E114* probably null Het
Arrdc1 C T 2: 24,926,146 G282S probably damaging Het
Atp1a3 A T 7: 24,981,791 L790Q probably damaging Het
Bend5 T A 4: 111,415,209 V12D probably damaging Het
Bod1l C T 5: 41,819,265 E1569K probably damaging Het
Cdc123 T A 2: 5,803,964 I234L probably benign Het
Cep126 T G 9: 8,120,748 E91D probably damaging Het
Cep89 T A 7: 35,414,145 D199E possibly damaging Het
Ces1d T C 8: 93,171,137 T442A probably benign Het
Chsy3 C T 18: 59,409,227 A479V probably benign Het
Clcn4 C A 7: 7,293,061 G261C probably damaging Het
Clhc1 A T 11: 29,557,651 probably null Het
Cnot3 T A 7: 3,655,566 probably null Het
Col9a1 C A 1: 24,237,180 P723H probably damaging Het
Crybg3 A T 16: 59,555,242 M169K probably benign Het
Cxxc4 A G 3: 134,258,053 R353G probably benign Het
Dennd3 A T 15: 73,540,808 I440F probably damaging Het
Elmo3 G T 8: 105,309,017 S553I probably damaging Het
Elovl2 A G 13: 41,187,467 Y198H probably benign Het
Epm2aip1 A G 9: 111,272,037 Y26C probably damaging Het
Ext1 A C 15: 53,089,939 C510G possibly damaging Het
Extl3 A T 14: 65,077,489 D81E probably benign Het
Fbxl5 T A 5: 43,758,676 T465S probably benign Het
Fbxo31 G A 8: 121,564,645 probably null Het
Gabrr2 A T 4: 33,081,470 K169* probably null Het
Gm10436 A T 12: 88,176,352 N360K possibly damaging Het
Haus4 A G 14: 54,542,145 Y341H probably damaging Het
Itgae A T 11: 73,120,273 probably null Het
Jmjd7 C T 2: 120,030,515 H149Y possibly damaging Het
Kcnh2 C T 5: 24,324,563 C725Y probably damaging Het
Mroh1 C T 15: 76,447,332 P1252L probably benign Het
Ms4a14 A G 19: 11,302,944 F750S probably benign Het
Naf1 T A 8: 66,860,513 D49E unknown Het
Notch3 T C 17: 32,122,773 T2002A possibly damaging Het
Olfr1413 G A 1: 92,574,088 D306N probably benign Het
Olfr1495 T A 19: 13,768,352 D3E probably benign Het
Olfr168 A T 16: 19,530,417 C168S probably damaging Het
Olfr301 A G 7: 86,407,911 probably benign Het
Olfr393 A T 11: 73,847,507 I206N probably benign Het
Olfr709-ps1 A T 7: 106,926,570 D296E probably benign Het
Olfr869 A T 9: 20,137,575 N153I probably benign Het
Pck1 A G 2: 173,155,950 T271A possibly damaging Het
Penk A G 4: 4,133,976 W224R possibly damaging Het
Per2 C A 1: 91,444,759 V198F probably damaging Het
Phf11d A G 14: 59,361,831 M23T probably damaging Het
Pla2g4d A G 2: 120,266,730 V796A probably benign Het
Prdx6 A T 1: 161,241,858 probably null Het
Prep A T 10: 45,091,012 N47I probably damaging Het
Prodh2 A T 7: 30,512,639 probably null Het
Prss38 G T 11: 59,375,170 H96N probably damaging Het
Rab11a C A 9: 64,728,331 E47* probably null Het
Rad18 C T 6: 112,649,837 G369D probably benign Het
Rragc T C 4: 123,929,924 V330A probably damaging Het
Serpina9 A T 12: 104,001,421 H238Q probably benign Het
Serpinb3b T A 1: 107,157,737 K91N probably damaging Het
Slc16a12 T G 19: 34,675,330 S139R probably benign Het
Slc22a27 T A 19: 7,910,107 probably null Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Slc38a9 A T 13: 112,731,614 I545F probably benign Het
Slc39a8 A T 3: 135,884,396 H349L probably damaging Het
Slk C T 19: 47,642,071 T1227I possibly damaging Het
Spdye4b A G 5: 143,194,854 E25G possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
St3gal1 A G 15: 67,111,265 V214A probably benign Het
St7l T A 3: 104,926,577 M550K probably benign Het
Tbk1 A C 10: 121,552,246 F638C possibly damaging Het
Tex101 A T 7: 24,669,765 C114S probably damaging Het
Ttll13 A G 7: 80,255,387 M384V probably benign Het
Ugt2b37 A T 5: 87,254,330 D147E probably damaging Het
Vmn1r10 A T 6: 57,113,701 T93S probably benign Het
Wasl G A 6: 24,619,397 P375S unknown Het
Wdr63 A G 3: 146,066,920 L457P probably damaging Het
Zfp839 A T 12: 110,855,626 R291S probably damaging Het
Other mutations in Zfp236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Zfp236 APN 18 82668690 missense probably benign 0.44
IGL01760:Zfp236 APN 18 82621422 missense probably damaging 1.00
IGL01923:Zfp236 APN 18 82682219 missense probably damaging 0.98
IGL01934:Zfp236 APN 18 82633120 missense probably damaging 0.99
IGL01949:Zfp236 APN 18 82624396 missense probably damaging 1.00
IGL02063:Zfp236 APN 18 82658151 missense probably benign
IGL02496:Zfp236 APN 18 82629992 missense probably damaging 1.00
IGL02513:Zfp236 APN 18 82630114 missense probably damaging 1.00
IGL02626:Zfp236 APN 18 82657995 splice site probably benign
IGL02880:Zfp236 APN 18 82624459 missense probably benign 0.15
IGL03156:Zfp236 APN 18 82680702 missense probably damaging 1.00
IGL03261:Zfp236 APN 18 82630608 missense possibly damaging 0.93
R0047:Zfp236 UTSW 18 82680692 missense probably damaging 1.00
R0052:Zfp236 UTSW 18 82639332 missense probably damaging 1.00
R0194:Zfp236 UTSW 18 82656987 missense probably damaging 1.00
R0207:Zfp236 UTSW 18 82640227 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0302:Zfp236 UTSW 18 82658088 missense probably damaging 0.99
R0730:Zfp236 UTSW 18 82640244 splice site probably benign
R0755:Zfp236 UTSW 18 82620332 missense probably damaging 1.00
R1202:Zfp236 UTSW 18 82628166 missense probably benign 0.00
R1449:Zfp236 UTSW 18 82646005 missense probably damaging 1.00
R1550:Zfp236 UTSW 18 82674424 missense possibly damaging 0.81
R1785:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R1786:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2042:Zfp236 UTSW 18 82633109 missense probably damaging 1.00
R2132:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2133:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2247:Zfp236 UTSW 18 82604298 missense possibly damaging 0.82
R2484:Zfp236 UTSW 18 82668637 missense probably benign 0.05
R3715:Zfp236 UTSW 18 82632970 splice site probably benign
R4003:Zfp236 UTSW 18 82680745 nonsense probably null
R4031:Zfp236 UTSW 18 82624465 missense probably damaging 1.00
R4482:Zfp236 UTSW 18 82644221 missense probably benign 0.04
R4492:Zfp236 UTSW 18 82630000 missense probably damaging 1.00
R4502:Zfp236 UTSW 18 82636954 missense probably benign 0.13
R4561:Zfp236 UTSW 18 82620406 missense probably damaging 1.00
R4649:Zfp236 UTSW 18 82597659 missense probably damaging 1.00
R4902:Zfp236 UTSW 18 82609418 missense possibly damaging 0.89
R5064:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R5084:Zfp236 UTSW 18 82609431 missense probably damaging 1.00
R5090:Zfp236 UTSW 18 82618881 missense probably benign 0.08
R5191:Zfp236 UTSW 18 82621423 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82630094 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82658073 missense probably damaging 0.99
R5339:Zfp236 UTSW 18 82624366 missense probably damaging 0.99
R5375:Zfp236 UTSW 18 82597688 missense possibly damaging 0.93
R5445:Zfp236 UTSW 18 82682156 missense probably benign 0.02
R5513:Zfp236 UTSW 18 82658022 missense probably damaging 0.97
R5527:Zfp236 UTSW 18 82658034 missense possibly damaging 0.51
R5628:Zfp236 UTSW 18 82657122 missense probably damaging 1.00
R5758:Zfp236 UTSW 18 82671709 missense probably damaging 1.00
R5890:Zfp236 UTSW 18 82640151 missense possibly damaging 0.87
R6137:Zfp236 UTSW 18 82671794 missense possibly damaging 0.89
R6193:Zfp236 UTSW 18 82604247 missense probably damaging 1.00
R6198:Zfp236 UTSW 18 82657153 missense probably damaging 1.00
R6239:Zfp236 UTSW 18 82657104 missense possibly damaging 0.53
R6705:Zfp236 UTSW 18 82633737 missense probably damaging 0.97
R6948:Zfp236 UTSW 18 82644062 missense possibly damaging 0.94
R6989:Zfp236 UTSW 18 82628363 missense probably damaging 1.00
R7002:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R7113:Zfp236 UTSW 18 82620337 missense possibly damaging 0.82
R7261:Zfp236 UTSW 18 82609345 missense possibly damaging 0.86
R7363:Zfp236 UTSW 18 82621331 missense probably damaging 1.00
R7447:Zfp236 UTSW 18 82633690 missense probably damaging 1.00
R7564:Zfp236 UTSW 18 82644241 nonsense probably null
R7731:Zfp236 UTSW 18 82680673 missense probably benign 0.27
R7857:Zfp236 UTSW 18 82668601 nonsense probably null
R7904:Zfp236 UTSW 18 82609382 missense possibly damaging 0.90
R7948:Zfp236 UTSW 18 82624415 missense probably damaging 1.00
R7995:Zfp236 UTSW 18 82639336 missense probably damaging 1.00
R8153:Zfp236 UTSW 18 82630027 missense probably damaging 1.00
R8435:Zfp236 UTSW 18 82640241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGACCTTGCTAACAGC -3'
(R):5'- AGACCGATGTTCACAGTGCC -3'

Sequencing Primer
(F):5'- ATGCTACAAGGCCTGTGAGC -3'
(R):5'- GATGTTCACAGTGCCACCAG -3'
Posted On2019-12-20