Incidental Mutation 'R7861:Thsd7b'
ID 607475
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Name thrombospondin, type I, domain containing 7B
Synonyms 1700074E13Rik, D130067I03Rik
MMRRC Submission 045914-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 129201039-130147015 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130087435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1184 (F1184Y)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
AlphaFold Q6P4U0
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: F1184Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: F1184Y

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,797,360 (GRCm39) I50F possibly damaging Het
Abcc3 T C 11: 94,248,075 (GRCm39) D1175G probably null Het
Accs C A 2: 93,666,077 (GRCm39) *503L probably null Het
Adgra2 A G 8: 27,604,485 (GRCm39) E520G probably damaging Het
Aldh7a1 C A 18: 56,681,525 (GRCm39) C215F probably benign Het
Apbb1ip A C 2: 22,706,990 (GRCm39) D9A unknown Het
Atad2 G A 15: 57,989,176 (GRCm39) A228V probably benign Het
Atp10a T C 7: 58,438,107 (GRCm39) S430P probably damaging Het
Atp1a3 T C 7: 24,700,573 (GRCm39) D6G unknown Het
Brca1 A T 11: 101,417,248 (GRCm39) N295K possibly damaging Het
Caly C A 7: 139,661,301 (GRCm39) probably benign Het
Ces1h A G 8: 94,084,053 (GRCm39) Y386H unknown Het
Col14a1 A G 15: 55,308,012 (GRCm39) D1044G unknown Het
Csf2rb A G 15: 78,233,357 (GRCm39) D888G probably damaging Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dhrs7b T A 11: 60,746,568 (GRCm39) L219Q probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnah14 C T 1: 181,444,324 (GRCm39) P545S probably damaging Het
Dnajc24 A T 2: 105,832,380 (GRCm39) M1K probably null Het
Dusp12 C T 1: 170,702,095 (GRCm39) W301* probably null Het
Dyrk1a G T 16: 94,492,575 (GRCm39) G603* probably null Het
Eif4g1 T A 16: 20,498,452 (GRCm39) V403E probably benign Het
Epn3 T C 11: 94,387,100 (GRCm39) E90G probably damaging Het
Etl4 A G 2: 20,810,721 (GRCm39) S1303G probably benign Het
Evpl A T 11: 116,118,895 (GRCm39) Y627N probably damaging Het
Fbxw25 A T 9: 109,493,625 (GRCm39) L22* probably null Het
Fcamr T A 1: 130,742,375 (GRCm39) N587K probably benign Het
Fgd6 A G 10: 93,939,193 (GRCm39) N946S probably benign Het
Fndc3b A T 3: 27,523,148 (GRCm39) I477N possibly damaging Het
Grifin C T 5: 140,550,280 (GRCm39) A54T probably benign Het
Gtf2b A G 3: 142,487,105 (GRCm39) I180M probably damaging Het
Invs A T 4: 48,397,559 (GRCm39) D378V possibly damaging Het
Itgb6 T C 2: 60,458,788 (GRCm39) E378G probably damaging Het
Khdc1a T C 1: 21,420,623 (GRCm39) I81T possibly damaging Het
Kif20b T A 19: 34,917,322 (GRCm39) D617E probably damaging Het
Kifc3 T A 8: 95,834,165 (GRCm39) probably null Het
Kirrel3 C T 9: 34,931,419 (GRCm39) H403Y possibly damaging Het
Klf15 G A 6: 90,443,820 (GRCm39) V132I probably benign Het
Kmt2a A G 9: 44,730,031 (GRCm39) S3429P unknown Het
Lama1 T G 17: 68,116,216 (GRCm39) L2361R Het
Lrp1b T C 2: 40,587,570 (GRCm39) D3895G Het
Mcoln3 A C 3: 145,830,546 (GRCm39) E92A possibly damaging Het
Myo3b T C 2: 69,939,032 (GRCm39) M135T probably damaging Het
Mysm1 A G 4: 94,835,204 (GRCm39) *820Q probably null Het
Ncoa7 A G 10: 30,567,056 (GRCm39) S541P probably benign Het
Nup54 T C 5: 92,578,952 (GRCm39) T33A unknown Het
Or10al2 C A 17: 37,983,408 (GRCm39) Q165K possibly damaging Het
Or13a17 T G 7: 140,271,484 (GRCm39) I222S probably damaging Het
Or1s2 T C 19: 13,758,810 (GRCm39) V276A possibly damaging Het
Or4k42 T A 2: 111,320,369 (GRCm39) I45F probably damaging Het
Or51a5 T A 7: 102,771,899 (GRCm39) I27F probably benign Het
Otud6b A G 4: 14,826,414 (GRCm39) C18R probably benign Het
Pde4d A G 13: 110,071,858 (GRCm39) E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pidd1 C A 7: 141,020,055 (GRCm39) W598L probably damaging Het
Pira2 A T 7: 3,847,543 (GRCm39) C49S probably damaging Het
Pramel11 T C 4: 143,624,288 (GRCm39) M70V possibly damaging Het
Prdx1 T G 4: 116,550,935 (GRCm39) D135E probably benign Het
Rab15 T A 12: 76,849,903 (GRCm39) Y88F probably damaging Het
Rem2 C A 14: 54,715,256 (GRCm39) H144Q probably damaging Het
Sel1l3 T C 5: 53,301,406 (GRCm39) D737G probably damaging Het
Srd5a3 C T 5: 76,295,666 (GRCm39) Q119* probably null Het
Suclg2 G T 6: 95,571,703 (GRCm39) Q120K probably benign Het
Tacc2 T A 7: 130,227,161 (GRCm39) M1282K probably benign Het
Tbc1d5 T A 17: 51,063,720 (GRCm39) Q620L probably damaging Het
Tdrd3 G T 14: 87,709,590 (GRCm39) A91S probably damaging Het
Trim28 T A 7: 12,762,339 (GRCm39) V321E possibly damaging Het
Trim5 C A 7: 103,915,675 (GRCm39) probably null Het
Ugt2b37 A T 5: 87,390,299 (GRCm39) Y382* probably null Het
Usp40 C T 1: 87,909,852 (GRCm39) G534D probably damaging Het
Usp53 A T 3: 122,728,112 (GRCm39) H823Q probably benign Het
Vmn2r12 T A 5: 109,235,829 (GRCm39) M508L probably benign Het
Vmn2r56 T A 7: 12,449,351 (GRCm39) I296F probably benign Het
Vps13a T C 19: 16,632,668 (GRCm39) S2563G probably damaging Het
Wdr59 A G 8: 112,220,912 (GRCm39) F207L Het
Zan A G 5: 137,405,295 (GRCm39) S3777P unknown Het
Zfp277 T C 12: 40,365,880 (GRCm39) N530D possibly damaging Het
Zfp365 G A 10: 67,745,749 (GRCm39) R10W probably damaging Het
Zfp384 A T 6: 125,013,288 (GRCm39) H452L probably damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve28 A T 5: 34,374,487 (GRCm39) L509Q probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129,523,571 (GRCm39) missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130,092,814 (GRCm39) missense probably benign 0.00
IGL00987:Thsd7b APN 1 129,541,016 (GRCm39) missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129,523,883 (GRCm39) missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129,704,071 (GRCm39) missense probably benign 0.29
IGL01535:Thsd7b APN 1 129,605,954 (GRCm39) missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130,145,918 (GRCm39) utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129,358,665 (GRCm39) missense probably benign 0.07
IGL01775:Thsd7b APN 1 129,556,676 (GRCm39) missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129,744,419 (GRCm39) missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129,523,508 (GRCm39) missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130,087,369 (GRCm39) missense probably benign 0.01
IGL02404:Thsd7b APN 1 129,540,888 (GRCm39) missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129,540,932 (GRCm39) missense probably benign 0.22
IGL02543:Thsd7b APN 1 130,092,840 (GRCm39) missense probably benign 0.03
IGL02740:Thsd7b APN 1 129,540,864 (GRCm39) missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129,843,352 (GRCm39) missense probably benign 0.01
IGL03108:Thsd7b APN 1 130,138,013 (GRCm39) missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130,116,288 (GRCm39) missense probably benign 0.00
IGL03195:Thsd7b APN 1 129,556,646 (GRCm39) missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129,688,092 (GRCm39) missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129,523,901 (GRCm39) missense probably benign 0.17
IGL03399:Thsd7b APN 1 129,556,622 (GRCm39) missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129,358,701 (GRCm39) missense probably benign 0.00
R0277:Thsd7b UTSW 1 130,123,000 (GRCm39) missense probably benign 0.00
R0526:Thsd7b UTSW 1 129,879,129 (GRCm39) missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130,116,263 (GRCm39) missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130,116,268 (GRCm39) missense probably benign 0.00
R0784:Thsd7b UTSW 1 129,523,096 (GRCm39) splice site probably benign
R1158:Thsd7b UTSW 1 130,117,672 (GRCm39) splice site probably null
R1267:Thsd7b UTSW 1 129,556,577 (GRCm39) splice site probably null
R1375:Thsd7b UTSW 1 130,087,423 (GRCm39) missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129,523,778 (GRCm39) missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1728:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1728:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1728:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1729:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1729:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1730:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1730:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1739:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1739:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1762:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1762:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 130,030,813 (GRCm39) missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1783:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1783:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1784:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1784:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1785:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1785:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1812:Thsd7b UTSW 1 129,686,347 (GRCm39) missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129,540,993 (GRCm39) missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129,605,846 (GRCm39) missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129,686,188 (GRCm39) nonsense probably null
R2199:Thsd7b UTSW 1 130,145,895 (GRCm39) missense probably benign 0.04
R2483:Thsd7b UTSW 1 130,030,809 (GRCm39) missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130,117,587 (GRCm39) splice site probably benign
R2935:Thsd7b UTSW 1 129,605,824 (GRCm39) missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 129,977,599 (GRCm39) missense probably benign 0.23
R3236:Thsd7b UTSW 1 130,145,855 (GRCm39) nonsense probably null
R3745:Thsd7b UTSW 1 129,605,978 (GRCm39) missense probably benign 0.04
R3877:Thsd7b UTSW 1 130,117,919 (GRCm39) missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129,523,107 (GRCm39) missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4112:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4255:Thsd7b UTSW 1 129,688,024 (GRCm39) missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129,358,652 (GRCm39) missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 129,977,646 (GRCm39) intron probably benign
R4732:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130,138,001 (GRCm39) missense probably benign 0.01
R4805:Thsd7b UTSW 1 130,116,276 (GRCm39) missense probably benign 0.04
R4840:Thsd7b UTSW 1 129,523,581 (GRCm39) missense probably benign 0.00
R4879:Thsd7b UTSW 1 130,116,236 (GRCm39) missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129,605,882 (GRCm39) missense probably benign 0.00
R4972:Thsd7b UTSW 1 130,116,309 (GRCm39) missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129,605,980 (GRCm39) nonsense probably null
R5422:Thsd7b UTSW 1 129,849,071 (GRCm39) missense probably benign 0.41
R5495:Thsd7b UTSW 1 129,523,570 (GRCm39) missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129,523,578 (GRCm39) missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130,090,673 (GRCm39) critical splice donor site probably null
R5638:Thsd7b UTSW 1 129,523,270 (GRCm39) missense probably benign 0.00
R5640:Thsd7b UTSW 1 130,044,408 (GRCm39) nonsense probably null
R5655:Thsd7b UTSW 1 129,556,671 (GRCm39) splice site probably null
R5711:Thsd7b UTSW 1 129,688,139 (GRCm39) missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129,605,821 (GRCm39) missense probably benign 0.00
R5888:Thsd7b UTSW 1 130,138,057 (GRCm39) nonsense probably null
R5932:Thsd7b UTSW 1 129,358,575 (GRCm39) missense probably benign
R6243:Thsd7b UTSW 1 130,090,599 (GRCm39) missense probably benign 0.21
R6258:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6260:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6399:Thsd7b UTSW 1 129,744,385 (GRCm39) missense probably benign 0.13
R6437:Thsd7b UTSW 1 129,744,419 (GRCm39) missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130,087,451 (GRCm39) splice site probably null
R6785:Thsd7b UTSW 1 129,358,644 (GRCm39) missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130,030,890 (GRCm39) missense probably benign 0.01
R7334:Thsd7b UTSW 1 130,123,012 (GRCm39) missense probably benign 0.00
R7414:Thsd7b UTSW 1 129,556,717 (GRCm39) missense probably damaging 0.99
R7673:Thsd7b UTSW 1 129,843,487 (GRCm39) splice site probably null
R7683:Thsd7b UTSW 1 129,523,683 (GRCm39) missense probably damaging 0.99
R8145:Thsd7b UTSW 1 129,688,036 (GRCm39) missense probably damaging 1.00
R8241:Thsd7b UTSW 1 130,117,688 (GRCm39) missense probably damaging 1.00
R8296:Thsd7b UTSW 1 129,523,193 (GRCm39) missense probably benign 0.01
R8355:Thsd7b UTSW 1 129,523,616 (GRCm39) missense probably damaging 1.00
R8507:Thsd7b UTSW 1 129,605,790 (GRCm39) missense probably benign 0.21
R8520:Thsd7b UTSW 1 129,849,157 (GRCm39) missense probably benign 0.07
R8555:Thsd7b UTSW 1 129,523,191 (GRCm39) missense probably damaging 1.00
R8682:Thsd7b UTSW 1 129,688,011 (GRCm39) nonsense probably null
R8981:Thsd7b UTSW 1 129,523,187 (GRCm39) missense possibly damaging 0.88
R9029:Thsd7b UTSW 1 130,087,426 (GRCm39) missense probably damaging 1.00
R9133:Thsd7b UTSW 1 129,843,382 (GRCm39) missense probably benign 0.18
R9194:Thsd7b UTSW 1 129,843,371 (GRCm39) missense possibly damaging 0.78
R9229:Thsd7b UTSW 1 129,849,027 (GRCm39) missense probably damaging 1.00
R9239:Thsd7b UTSW 1 130,087,453 (GRCm39) critical splice donor site probably null
R9460:Thsd7b UTSW 1 130,090,674 (GRCm39) critical splice donor site probably null
R9466:Thsd7b UTSW 1 130,122,866 (GRCm39) missense probably benign
R9588:Thsd7b UTSW 1 130,108,223 (GRCm39) missense probably damaging 1.00
X0027:Thsd7b UTSW 1 129,523,809 (GRCm39) missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129,556,648 (GRCm39) missense probably benign 0.17
Z1176:Thsd7b UTSW 1 129,523,397 (GRCm39) missense probably benign 0.01
Z1176:Thsd7b UTSW 1 129,523,253 (GRCm39) missense probably damaging 0.98
Z1176:Thsd7b UTSW 1 130,108,161 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCCTGCATGTGTACATTTAAC -3'
(R):5'- TGGCCTTGATGTATCTACAAGC -3'

Sequencing Primer
(F):5'- AAGAACTCGGCATCTGCT -3'
(R):5'- GATGTATCTACAAGCCATGAATGG -3'
Posted On 2019-12-20