Incidental Mutation 'R7861:Fcamr'
ID607476
Institutional Source Beutler Lab
Gene Symbol Fcamr
Ensembl Gene ENSMUSG00000026415
Gene NameFc receptor, IgA, IgM, high affinity
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7861 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130800902-130814740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130814638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 587 (N587K)
Ref Sequence ENSEMBL: ENSMUSP00000108096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027670] [ENSMUST00000112477]
Predicted Effect probably benign
Transcript: ENSMUST00000027670
AA Change: N531K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027670
Gene: ENSMUSG00000026415
AA Change: N531K

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 87 191 1.19e-5 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
transmembrane domain 456 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112477
AA Change: N587K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108096
Gene: ENSMUSG00000026415
AA Change: N587K

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
IG 143 247 1.19e-5 SMART
low complexity region 264 276 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
transmembrane domain 512 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have enhanced germinal center formation, affinity maturation and memory induction of IgG3 producing B cells after immunization with T cell-independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Fcamr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Fcamr APN 1 130813214 missense probably benign 0.01
IGL02880:Fcamr APN 1 130813334 missense probably benign 0.00
IGL03199:Fcamr APN 1 130812918 missense probably damaging 1.00
IGL03392:Fcamr APN 1 130800948 utr 5 prime probably benign
IGL03398:Fcamr APN 1 130803248 missense probably damaging 0.97
R1101:Fcamr UTSW 1 130814486 splice site probably null
R1312:Fcamr UTSW 1 130811487 missense probably damaging 1.00
R1351:Fcamr UTSW 1 130813020 missense possibly damaging 0.83
R1387:Fcamr UTSW 1 130804642 missense possibly damaging 0.85
R1475:Fcamr UTSW 1 130814484 splice site probably null
R1728:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1728:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1728:Fcamr UTSW 1 130811580 missense probably benign
R1728:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1728:Fcamr UTSW 1 130812692 missense probably benign
R1728:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1728:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1728:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1728:Fcamr UTSW 1 130814597 missense probably benign
R1729:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1729:Fcamr UTSW 1 130811580 missense probably benign
R1729:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1729:Fcamr UTSW 1 130812692 missense probably benign
R1729:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1729:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1729:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1729:Fcamr UTSW 1 130814597 missense probably benign
R1730:Fcamr UTSW 1 130811580 missense probably benign
R1730:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1730:Fcamr UTSW 1 130812692 missense probably benign
R1730:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1730:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1730:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1730:Fcamr UTSW 1 130814597 missense probably benign
R1739:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1739:Fcamr UTSW 1 130811580 missense probably benign
R1739:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1739:Fcamr UTSW 1 130812692 missense probably benign
R1739:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1739:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1739:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1739:Fcamr UTSW 1 130814597 missense probably benign
R1762:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1762:Fcamr UTSW 1 130811580 missense probably benign
R1762:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1762:Fcamr UTSW 1 130812692 missense probably benign
R1762:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1762:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1762:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1762:Fcamr UTSW 1 130814597 missense probably benign
R1783:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1783:Fcamr UTSW 1 130811580 missense probably benign
R1783:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1783:Fcamr UTSW 1 130812692 missense probably benign
R1783:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1783:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1783:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1783:Fcamr UTSW 1 130814597 missense probably benign
R1784:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1784:Fcamr UTSW 1 130811580 missense probably benign
R1784:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1784:Fcamr UTSW 1 130812692 missense probably benign
R1784:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1784:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1784:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1784:Fcamr UTSW 1 130814597 missense probably benign
R1785:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1785:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1785:Fcamr UTSW 1 130811580 missense probably benign
R1785:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1785:Fcamr UTSW 1 130812692 missense probably benign
R1785:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1785:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1785:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1785:Fcamr UTSW 1 130814597 missense probably benign
R1793:Fcamr UTSW 1 130811547 missense probably benign 0.03
R2085:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R3937:Fcamr UTSW 1 130804576 missense probably damaging 0.97
R4529:Fcamr UTSW 1 130804576 missense probably damaging 0.99
R4624:Fcamr UTSW 1 130803262 missense probably damaging 0.99
R4822:Fcamr UTSW 1 130812686 missense possibly damaging 0.82
R5055:Fcamr UTSW 1 130811437 missense probably damaging 1.00
R5514:Fcamr UTSW 1 130814056 missense probably damaging 1.00
R5807:Fcamr UTSW 1 130811526 missense probably damaging 1.00
R6077:Fcamr UTSW 1 130812926 missense probably damaging 1.00
R6200:Fcamr UTSW 1 130803190 missense probably benign 0.16
R6653:Fcamr UTSW 1 130813202 missense possibly damaging 0.89
R7081:Fcamr UTSW 1 130813212 missense probably damaging 1.00
R7362:Fcamr UTSW 1 130814023 missense possibly damaging 0.52
R7828:Fcamr UTSW 1 130811706 missense probably damaging 1.00
R8188:Fcamr UTSW 1 130802928 splice site probably null
R8869:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R8907:Fcamr UTSW 1 130812591 missense probably damaging 1.00
X0012:Fcamr UTSW 1 130812734 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGACCAATCAATATGTTCTAAGGGC -3'
(R):5'- TTCAGAGAATGCCTGGCCTC -3'

Sequencing Primer
(F):5'- GTTCTAAGGGCCTAGCTACTAGAC -3'
(R):5'- TCTGAGGCCCAAGCTGGTATG -3'
Posted On2019-12-20