Mutagenetix > Incidental Mutation

Incidental Mutation 'R7861:Etl4'

607479

Institutional Source

Beutler Lab

Gene Symbol

Etl4

Ensembl Gene

ENSMUSG00000036617

Gene Name

enhancer trap locus 4

Synonyms

6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19909780-20810713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20805910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1303 (S1303G)

Ref Sequence

ENSEMBL: ENSMUSP00000110274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]

AlphaFold

A2AQ25

Predicted Effect

probably benign
Transcript: ENSMUST00000045555

SMART Domains

Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1067	1096	N/A	INTRINSIC
low complexity region	1212	1231	N/A	INTRINSIC
low complexity region	1296	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066509
AA Change: S1252G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: S1252G

Domain	Start	End	E-Value	Type
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1372	1381	N/A	INTRINSIC
low complexity region	1470	1495	N/A	INTRINSIC
low complexity region	1571	1582	N/A	INTRINSIC
coiled coil region	1658	1686	N/A	INTRINSIC
low complexity region	1724	1737	N/A	INTRINSIC
low complexity region	1806	1825	N/A	INTRINSIC
low complexity region	1890	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114604

SMART Domains

Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1207	1226	N/A	INTRINSIC
low complexity region	1291	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114606

SMART Domains

Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114607

SMART Domains

Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114608
AA Change: S935G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: S935G

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC
low complexity region	1055	1064	N/A	INTRINSIC
low complexity region	1153	1178	N/A	INTRINSIC
low complexity region	1254	1265	N/A	INTRINSIC
coiled coil region	1341	1369	N/A	INTRINSIC
low complexity region	1407	1420	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114614

SMART Domains

Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
low complexity region	1201	1220	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114627
AA Change: S1303G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: S1303G

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Pfam:AIP3	239	341	2.4e-14	PFAM
low complexity region	364	379	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
Pfam:AIP3	600	841	1.1e-12	PFAM
low complexity region	1153	1182	N/A	INTRINSIC
low complexity region	1423	1432	N/A	INTRINSIC
low complexity region	1521	1546	N/A	INTRINSIC
low complexity region	1622	1633	N/A	INTRINSIC
coiled coil region	1709	1737	N/A	INTRINSIC
low complexity region	1775	1788	N/A	INTRINSIC
low complexity region	1857	1876	N/A	INTRINSIC
low complexity region	1941	1959	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Brca1	A	T	11: 101,526,422	N295K	possibly damaging	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Evpl	A	T	11: 116,228,069	Y627N	probably damaging	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Invs	A	T	4: 48,397,559	D378V	possibly damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kifc3	T	A	8: 95,107,537		probably null	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pidd1	C	A	7: 141,440,142	W598L	probably damaging	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Etl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Etl4	APN	2	20766478	missense	possibly damaging	0.81
IGL00944:Etl4	APN	2	20530054	missense	possibly damaging	0.52
IGL01078:Etl4	APN	2	20806531	nonsense	probably null
IGL01099:Etl4	APN	2	20807111	missense	probably benign	0.06
IGL01337:Etl4	APN	2	20785387	missense	probably benign	0.01
IGL01348:Etl4	APN	2	20806973	missense	probably damaging	1.00
IGL01349:Etl4	APN	2	20713396	missense	probably damaging	1.00
IGL01407:Etl4	APN	2	20743856	missense	probably damaging	0.99
IGL01552:Etl4	APN	2	20778189	missense	probably damaging	0.99
IGL01662:Etl4	APN	2	20806649	missense	probably benign	0.04
IGL01687:Etl4	APN	2	20530087	missense	probably damaging	1.00
IGL01793:Etl4	APN	2	20743898	missense	possibly damaging	0.87
IGL01844:Etl4	APN	2	20806682	missense	probably benign	0.06
IGL02025:Etl4	APN	2	20806526	missense	probably damaging	1.00
IGL02088:Etl4	APN	2	20806548	missense	probably damaging	1.00
IGL02134:Etl4	APN	2	20806429	missense	possibly damaging	0.79
IGL02369:Etl4	APN	2	20530189	missense	probably damaging	1.00
IGL02480:Etl4	APN	2	20788524	missense	probably damaging	0.99
IGL02560:Etl4	APN	2	20743718	missense	probably damaging	1.00
IGL02851:Etl4	APN	2	20808029	missense	possibly damaging	0.46
IGL02893:Etl4	APN	2	20760210	splice site	probably benign
IGL02951:Etl4	APN	2	20801537	splice site	probably benign
IGL03119:Etl4	APN	2	20713387	missense	probably damaging	1.00
IGL03267:Etl4	APN	2	20785182	nonsense	probably null
IGL03379:Etl4	APN	2	20662016	missense	possibly damaging	0.87
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0095:Etl4	UTSW	2	20743868	missense	probably damaging	1.00
R0100:Etl4	UTSW	2	20339905	missense	probably benign
R0311:Etl4	UTSW	2	20807129	missense	probably damaging	1.00
R0346:Etl4	UTSW	2	20759652	critical splice donor site	probably null
R0348:Etl4	UTSW	2	20778129	missense	probably damaging	1.00
R0379:Etl4	UTSW	2	20807354	missense	probably damaging	0.98
R0571:Etl4	UTSW	2	20743769	missense	probably damaging	0.99
R0697:Etl4	UTSW	2	20743861	missense	probably damaging	1.00
R0707:Etl4	UTSW	2	20805571	splice site	probably benign
R0980:Etl4	UTSW	2	20801567	missense	probably damaging	1.00
R1120:Etl4	UTSW	2	20806703	missense	probably benign	0.00
R1254:Etl4	UTSW	2	20807923	missense	probably damaging	1.00
R1346:Etl4	UTSW	2	20806144	missense	possibly damaging	0.94
R1460:Etl4	UTSW	2	20788477	missense	probably damaging	1.00
R1503:Etl4	UTSW	2	20743874	missense	possibly damaging	0.94
R1547:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R1627:Etl4	UTSW	2	20801579	missense	possibly damaging	0.91
R1635:Etl4	UTSW	2	20806408	missense	probably damaging	1.00
R1716:Etl4	UTSW	2	20743681	missense	probably damaging	1.00
R1795:Etl4	UTSW	2	20808026	critical splice donor site	probably null
R1885:Etl4	UTSW	2	20743984	missense	probably damaging	1.00
R2039:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R2083:Etl4	UTSW	2	20743549	missense	probably damaging	1.00
R2109:Etl4	UTSW	2	20785342	missense	probably benign	0.27
R2153:Etl4	UTSW	2	20798734	missense	probably benign	0.00
R2403:Etl4	UTSW	2	20807306	nonsense	probably null
R2883:Etl4	UTSW	2	20806174	missense	possibly damaging	0.83
R2985:Etl4	UTSW	2	20781849	missense	probably damaging	1.00
R3402:Etl4	UTSW	2	20781882	missense	probably damaging	1.00
R3696:Etl4	UTSW	2	20801662	critical splice donor site	probably null
R3755:Etl4	UTSW	2	20743537	missense	probably benign	0.10
R3813:Etl4	UTSW	2	20788435	missense	probably damaging	1.00
R3829:Etl4	UTSW	2	20785421	missense	probably benign	0.07
R3887:Etl4	UTSW	2	20529961	nonsense	probably null
R3888:Etl4	UTSW	2	20529961	nonsense	probably null
R3889:Etl4	UTSW	2	20529961	nonsense	probably null
R3958:Etl4	UTSW	2	20340043	missense	probably benign
R3959:Etl4	UTSW	2	20340043	missense	probably benign
R3960:Etl4	UTSW	2	20340043	missense	probably benign
R4058:Etl4	UTSW	2	20806019	missense	possibly damaging	0.59
R4074:Etl4	UTSW	2	20809219	utr 3 prime	probably benign
R4077:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4078:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4127:Etl4	UTSW	2	20744075	missense	possibly damaging	0.93
R4200:Etl4	UTSW	2	20781883	missense	probably damaging	1.00
R4492:Etl4	UTSW	2	20806865	missense	possibly damaging	0.67
R4514:Etl4	UTSW	2	20661898	missense	probably damaging	1.00
R4820:Etl4	UTSW	2	20806685	missense	possibly damaging	0.85
R4825:Etl4	UTSW	2	20806927	missense	probably damaging	1.00
R4888:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R4938:Etl4	UTSW	2	20798649	missense	probably benign	0.00
R4943:Etl4	UTSW	2	20807281	missense	probably benign	0.05
R5121:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R5191:Etl4	UTSW	2	20339999	missense	probably damaging	0.99
R5198:Etl4	UTSW	2	20713387	missense	probably damaging	1.00
R5199:Etl4	UTSW	2	20744042	missense	probably damaging	1.00
R5470:Etl4	UTSW	2	20529980	missense	probably damaging	0.99
R5513:Etl4	UTSW	2	20743827	missense	probably damaging	1.00
R5620:Etl4	UTSW	2	20530226	missense	probably damaging	1.00
R5635:Etl4	UTSW	2	20807035	missense	probably damaging	1.00
R5641:Etl4	UTSW	2	20806462	frame shift	probably null
R5690:Etl4	UTSW	2	20805836	missense	probably benign	0.01
R5784:Etl4	UTSW	2	20806205	missense	possibly damaging	0.79
R5794:Etl4	UTSW	2	20806512	missense	probably damaging	1.00
R5908:Etl4	UTSW	2	20743907	missense	probably damaging	0.96
R5982:Etl4	UTSW	2	20781015	missense	probably damaging	1.00
R6151:Etl4	UTSW	2	20713360	missense	probably damaging	1.00
R6192:Etl4	UTSW	2	20801551	missense	probably damaging	0.98
R6238:Etl4	UTSW	2	20801568	missense	probably damaging	1.00
R6248:Etl4	UTSW	2	20809089	missense	possibly damaging	0.90
R6292:Etl4	UTSW	2	20743573	missense	probably damaging	1.00
R6610:Etl4	UTSW	2	20713369	missense	probably damaging	1.00
R6739:Etl4	UTSW	2	20713435	missense	probably damaging	1.00
R6846:Etl4	UTSW	2	20744108	missense	possibly damaging	0.94
R6863:Etl4	UTSW	2	20806309	missense	probably benign	0.01
R6873:Etl4	UTSW	2	20797992	splice site	probably null
R7003:Etl4	UTSW	2	20805884	missense	probably benign	0.03
R7155:Etl4	UTSW	2	20806931	missense	probably damaging	0.96
R7207:Etl4	UTSW	2	20709576	missense	probably damaging	0.99
R7230:Etl4	UTSW	2	20797988	missense	probably damaging	1.00
R7305:Etl4	UTSW	2	20709557	missense	probably damaging	1.00
R7389:Etl4	UTSW	2	20785093	nonsense	probably null
R7396:Etl4	UTSW	2	20798638	missense	possibly damaging	0.62
R7441:Etl4	UTSW	2	20744189	missense	possibly damaging	0.87
R7626:Etl4	UTSW	2	20713378	missense	probably damaging	1.00
R7776:Etl4	UTSW	2	20807146	missense	probably damaging	0.99
R7779:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R7798:Etl4	UTSW	2	20781946	critical splice donor site	probably null
R7851:Etl4	UTSW	2	20744140	missense	probably damaging	1.00
R7901:Etl4	UTSW	2	20290010	missense	possibly damaging	0.83
R8053:Etl4	UTSW	2	20661963	missense	probably damaging	1.00
R8124:Etl4	UTSW	2	20806640	missense	probably benign	0.06
R8133:Etl4	UTSW	2	20806271	missense	possibly damaging	0.86
R8203:Etl4	UTSW	2	20785105	missense	possibly damaging	0.61
R8238:Etl4	UTSW	2	20806531	nonsense	probably null
R8263:Etl4	UTSW	2	20744154	missense	probably benign	0.00
R8299:Etl4	UTSW	2	20744063	missense	possibly damaging	0.81
R8318:Etl4	UTSW	2	20788530	missense	probably damaging	1.00
R8334:Etl4	UTSW	2	20781046	missense	probably damaging	0.96
R8443:Etl4	UTSW	2	20806166	missense	probably benign	0.04
R8525:Etl4	UTSW	2	20530081	missense	probably damaging	1.00
R8679:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R8918:Etl4	UTSW	2	20743922	missense	probably benign
R8918:Etl4	UTSW	2	20806435	missense	probably benign	0.00
R9062:Etl4	UTSW	2	20743805	missense	probably damaging	0.99
R9095:Etl4	UTSW	2	20778153	missense	probably damaging	1.00
R9200:Etl4	UTSW	2	20781891	missense	probably damaging	1.00
R9416:Etl4	UTSW	2	20743973	missense	probably benign	0.17
R9437:Etl4	UTSW	2	20809061	missense	probably benign	0.20
R9451:Etl4	UTSW	2	20809115	missense	probably benign	0.03
R9489:Etl4	UTSW	2	20766534	missense	possibly damaging	0.75
R9531:Etl4	UTSW	2	20290007	start codon destroyed	probably null	0.01
R9605:Etl4	UTSW	2	20766534	missense	possibly damaging	0.75
R9623:Etl4	UTSW	2	20806241	missense
R9631:Etl4	UTSW	2	20661938	missense	probably benign	0.28
R9632:Etl4	UTSW	2	20661938	missense	probably benign	0.28
R9646:Etl4	UTSW	2	20797913	missense	probably benign	0.00
R9732:Etl4	UTSW	2	20743562	missense	probably damaging	0.98
R9755:Etl4	UTSW	2	20785237	missense	probably benign	0.17
R9771:Etl4	UTSW	2	20806726	missense	probably benign
RF003:Etl4	UTSW	2	20519918	nonsense	probably null
X0018:Etl4	UTSW	2	20809190	missense	probably damaging	0.98
X0022:Etl4	UTSW	2	20709564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTTGTAGAGCCTTTCTGG -3'
(R):5'- AGGAATGTGACTCTTGTCTGC -3'

Sequencing Primer
(F):5'- CCTTGTAGAGCCTTTCTGGATTAATG -3'
(R):5'- GAATGTGACTCTTGTCTGCATTTTC -3'

Posted On

2019-12-20