Incidental Mutation 'R7861:Myo3b'
ID 607483
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70108688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 135 (M135T)
Ref Sequence ENSEMBL: ENSMUSP00000107860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: M214T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: M214T

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112241
AA Change: M135T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064
AA Change: M135T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: M186T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: M186T

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCATGGGAAAGATATGACCC -3'
(R):5'- AGTCCTGATTCTCTGAGATTAAGTC -3'

Sequencing Primer
(F):5'- GATATGGGCACACTCACTCATTG -3'
(R):5'- AAGTCTTATCAGTCAGTATCCCTCAC -3'
Posted On 2019-12-20