Incidental Mutation 'R7861:Mcoln3'
ID 607490
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Name mucolipin 3
Synonyms varitint-waddler, Va, 6720490O21Rik, TRPML3
MMRRC Submission 045914-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 146117450-146141806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 146124791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 92 (E92A)
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450] [ENSMUST00000140214]
AlphaFold Q8R4F0
Predicted Effect possibly damaging
Transcript: ENSMUST00000039450
AA Change: E92A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: E92A

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140214
AA Change: E92A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115655
Gene: ENSMUSG00000036853
AA Change: E92A

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 (GRCm38) I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 (GRCm38) D1175G probably null Het
Accs C A 2: 93,835,732 (GRCm38) *503L probably null Het
Adgra2 A G 8: 27,114,457 (GRCm38) E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 (GRCm38) C215F probably benign Het
Apbb1ip A C 2: 22,816,978 (GRCm38) D9A unknown Het
Atad2 G A 15: 58,125,780 (GRCm38) A228V probably benign Het
Atp10a T C 7: 58,788,359 (GRCm38) S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 (GRCm38) D6G unknown Het
Brca1 A T 11: 101,526,422 (GRCm38) N295K possibly damaging Het
Caly C A 7: 140,081,388 (GRCm38) probably benign Het
Ces1h A G 8: 93,357,425 (GRCm38) Y386H unknown Het
Col14a1 A G 15: 55,444,616 (GRCm38) D1044G unknown Het
Csf2rb A G 15: 78,349,157 (GRCm38) D888G probably damaging Het
Cux1 T C 5: 136,252,604 (GRCm38) E568G possibly damaging Het
Dhrs7b T A 11: 60,855,742 (GRCm38) L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 (GRCm38) P80L probably damaging Het
Dnah14 C T 1: 181,616,759 (GRCm38) P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 (GRCm38) M1K probably null Het
Dusp12 C T 1: 170,874,526 (GRCm38) W301* probably null Het
Dyrk1a G T 16: 94,691,716 (GRCm38) G603* probably null Het
Eif4g1 T A 16: 20,679,702 (GRCm38) V403E probably benign Het
Epn3 T C 11: 94,496,274 (GRCm38) E90G probably damaging Het
Etl4 A G 2: 20,805,910 (GRCm38) S1303G probably benign Het
Evpl A T 11: 116,228,069 (GRCm38) Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 (GRCm38) L22* probably null Het
Fcamr T A 1: 130,814,638 (GRCm38) N587K probably benign Het
Fgd6 A G 10: 94,103,331 (GRCm38) N946S probably benign Het
Fndc3b A T 3: 27,468,999 (GRCm38) I477N possibly damaging Het
Grifin C T 5: 140,564,525 (GRCm38) A54T probably benign Het
Gtf2b A G 3: 142,781,344 (GRCm38) I180M probably damaging Het
Invs A T 4: 48,397,559 (GRCm38) D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 (GRCm38) E378G probably damaging Het
Khdc1a T C 1: 21,350,399 (GRCm38) I81T possibly damaging Het
Kif20b T A 19: 34,939,922 (GRCm38) D617E probably damaging Het
Kifc3 T A 8: 95,107,537 (GRCm38) probably null Het
Kirrel3 C T 9: 35,020,123 (GRCm38) H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 (GRCm38) V132I probably benign Het
Kmt2a A G 9: 44,818,734 (GRCm38) S3429P unknown Het
Lama1 T G 17: 67,809,221 (GRCm38) L2361R Het
Lrp1b T C 2: 40,697,558 (GRCm38) D3895G Het
Myo3b T C 2: 70,108,688 (GRCm38) M135T probably damaging Het
Mysm1 A G 4: 94,946,967 (GRCm38) *820Q probably null Het
Ncoa7 A G 10: 30,691,060 (GRCm38) S541P probably benign Het
Nup54 T C 5: 92,431,093 (GRCm38) T33A unknown Het
Or10al2 C A 17: 37,672,517 (GRCm38) Q165K possibly damaging Het
Or13a17 T G 7: 140,691,571 (GRCm38) I222S probably damaging Het
Or1s2 T C 19: 13,781,446 (GRCm38) V276A possibly damaging Het
Or4k42 T A 2: 111,490,024 (GRCm38) I45F probably damaging Het
Or51a5 T A 7: 103,122,692 (GRCm38) I27F probably benign Het
Otud6b A G 4: 14,826,414 (GRCm38) C18R probably benign Het
Pde4d A G 13: 109,935,324 (GRCm38) E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm38) probably benign Het
Pidd1 C A 7: 141,440,142 (GRCm38) W598L probably damaging Het
Pira2 A T 7: 3,844,544 (GRCm38) C49S probably damaging Het
Pramel11 T C 4: 143,897,718 (GRCm38) M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 (GRCm38) D135E probably benign Het
Rab15 T A 12: 76,803,129 (GRCm38) Y88F probably damaging Het
Rem2 C A 14: 54,477,799 (GRCm38) H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 (GRCm38) D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 (GRCm38) Q119* probably null Het
Suclg2 G T 6: 95,594,722 (GRCm38) Q120K probably benign Het
Tacc2 T A 7: 130,625,431 (GRCm38) M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 (GRCm38) Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 (GRCm38) A91S probably damaging Het
Thsd7b T A 1: 130,159,698 (GRCm38) F1184Y probably benign Het
Trim28 T A 7: 13,028,412 (GRCm38) V321E possibly damaging Het
Trim5 C A 7: 104,266,468 (GRCm38) probably null Het
Ugt2b37 A T 5: 87,242,440 (GRCm38) Y382* probably null Het
Usp40 C T 1: 87,982,130 (GRCm38) G534D probably damaging Het
Usp53 A T 3: 122,934,463 (GRCm38) H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 (GRCm38) M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 (GRCm38) I296F probably benign Het
Vps13a T C 19: 16,655,304 (GRCm38) S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 (GRCm38) F207L Het
Zan A G 5: 137,407,033 (GRCm38) S3777P unknown Het
Zfp277 T C 12: 40,315,881 (GRCm38) N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 (GRCm38) R10W probably damaging Het
Zfp384 A T 6: 125,036,325 (GRCm38) H452L probably damaging Het
Zftraf1 C T 15: 76,648,186 (GRCm38) D241N probably benign Het
Zfyve28 A T 5: 34,217,143 (GRCm38) L509Q probably damaging Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 146,133,928 (GRCm38) missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 146,137,264 (GRCm38) missense probably benign 0.01
IGL01712:Mcoln3 APN 3 146,128,264 (GRCm38) unclassified probably benign
IGL02115:Mcoln3 APN 3 146,137,301 (GRCm38) missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 146,133,909 (GRCm38) missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 146,124,749 (GRCm38) missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 146,140,576 (GRCm38) nonsense probably null
R1981:Mcoln3 UTSW 3 146,140,590 (GRCm38) nonsense probably null
R2056:Mcoln3 UTSW 3 146,128,224 (GRCm38) missense probably benign 0.01
R3000:Mcoln3 UTSW 3 146,133,907 (GRCm38) missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 146,140,492 (GRCm38) missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 146,131,204 (GRCm38) missense probably benign 0.01
R4950:Mcoln3 UTSW 3 146,139,519 (GRCm38) missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 146,128,122 (GRCm38) missense probably benign 0.00
R6302:Mcoln3 UTSW 3 146,124,772 (GRCm38) missense probably benign 0.00
R6353:Mcoln3 UTSW 3 146,131,154 (GRCm38) missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 146,128,187 (GRCm38) missense probably benign
R6915:Mcoln3 UTSW 3 146,137,256 (GRCm38) critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 146,139,492 (GRCm38) missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 146,139,475 (GRCm38) missense probably damaging 1.00
R8348:Mcoln3 UTSW 3 146,131,219 (GRCm38) missense probably damaging 1.00
R8509:Mcoln3 UTSW 3 146,124,892 (GRCm38) missense probably benign 0.00
R8708:Mcoln3 UTSW 3 146,140,521 (GRCm38) nonsense probably null
R8838:Mcoln3 UTSW 3 146,139,371 (GRCm38) missense probably damaging 1.00
R8861:Mcoln3 UTSW 3 146,139,404 (GRCm38) missense probably damaging 1.00
R8981:Mcoln3 UTSW 3 146,121,799 (GRCm38) missense probably benign
Z1176:Mcoln3 UTSW 3 146,140,466 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCCCATAGTCATACTGGAC -3'
(R):5'- TCTTTCTCCCAAGAATGCACAC -3'

Sequencing Primer
(F):5'- GGGATTTGAACTCAGGTCCTCATAC -3'
(R):5'- GTAAGGCCCAGAGTTTAACCCTTG -3'
Posted On 2019-12-20