Incidental Mutation 'R7861:Otud6b'
ID 607491
Institutional Source Beutler Lab
Gene Symbol Otud6b
Ensembl Gene ENSMUSG00000040550
Gene Name OTU domain containing 6B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 14809498-14826587 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14826414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 18 (C18R)
Ref Sequence ENSEMBL: ENSMUSP00000113553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117268]
AlphaFold Q8K2H2
Predicted Effect probably benign
Transcript: ENSMUST00000117268
AA Change: C18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113553
Gene: ENSMUSG00000040550
AA Change: C18R

DomainStartEndE-ValueType
coiled coil region 33 106 N/A INTRINSIC
Pfam:Peptidase_C65 129 322 9.5e-8 PFAM
Pfam:OTU 185 310 6.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151012
SMART Domains Protein: ENSMUSP00000120430
Gene: ENSMUSG00000040550

DomainStartEndE-ValueType
coiled coil region 9 82 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ovarian tumor domain (OTU)-containing subfamily of deubiquitinating enzymes. Deubiquitinating enzymes are primarily involved in removing ubiquitin from proteins targeted for degradation. This protein may function as a negative regulator of the cell cycle in B cells. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete perinatal lethality, decreased fetal size, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Otud6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Otud6b APN 4 14811732 missense probably damaging 1.00
IGL01293:Otud6b APN 4 14822682 splice site probably benign
IGL01903:Otud6b APN 4 14818458 missense probably benign 0.10
IGL02193:Otud6b APN 4 14812543 missense probably damaging 0.96
IGL03372:Otud6b APN 4 14812519 missense possibly damaging 0.95
PIT4402001:Otud6b UTSW 4 14818185 missense probably damaging 0.99
R0587:Otud6b UTSW 4 14815661 missense probably benign 0.08
R0841:Otud6b UTSW 4 14812532 missense probably benign 0.02
R1145:Otud6b UTSW 4 14812532 missense probably benign 0.02
R1145:Otud6b UTSW 4 14812532 missense probably benign 0.02
R1416:Otud6b UTSW 4 14818473 missense probably damaging 0.98
R1676:Otud6b UTSW 4 14825617 missense probably damaging 0.99
R4982:Otud6b UTSW 4 14815607 missense probably damaging 1.00
R5024:Otud6b UTSW 4 14826293 missense probably damaging 1.00
R5615:Otud6b UTSW 4 14818187 missense possibly damaging 0.52
R6327:Otud6b UTSW 4 14826496 unclassified probably benign
R6419:Otud6b UTSW 4 14822766 missense possibly damaging 0.95
R6713:Otud6b UTSW 4 14822739 missense probably benign 0.34
R7073:Otud6b UTSW 4 14811743 missense probably damaging 1.00
R7423:Otud6b UTSW 4 14825858 splice site probably null
R7743:Otud6b UTSW 4 14818389 missense possibly damaging 0.81
R8095:Otud6b UTSW 4 14825614 missense probably damaging 1.00
R9200:Otud6b UTSW 4 14811712 nonsense probably null
R9492:Otud6b UTSW 4 14818349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACCAGAGGACACACTC -3'
(R):5'- GTCCTTAATCGCACAATCCCAG -3'

Sequencing Primer
(F):5'- GAGGACACACTCCACGCTC -3'
(R):5'- GCACAATCCCAGCTTCCGG -3'
Posted On 2019-12-20