Mutagenetix > Incidental Mutation

Incidental Mutation 'R7861:Invs'

607492

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

045914-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48397559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 378 (D378V)

Ref Sequence

ENSEMBL: ENSMUSP00000030029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030029
AA Change: D378V

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: D378V

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143433
AA Change: D322V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: D322V

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Brca1	A	T	11: 101,526,422	N295K	possibly damaging	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Etl4	A	G	2: 20,805,910	S1303G	probably benign	Het
Evpl	A	T	11: 116,228,069	Y627N	probably damaging	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kifc3	T	A	8: 95,107,537		probably null	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pidd1	C	A	7: 141,440,142	W598L	probably damaging	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5560:Invs	UTSW	4	48416084	missense	probably benign	0.00
R5748:Invs	UTSW	4	48307823	missense	probably damaging	0.98
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5840:Invs	UTSW	4	48396284	missense	probably damaging	1.00
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7263:Invs	UTSW	4	48396381	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7503:Invs	UTSW	4	48396347	missense	probably damaging	0.96
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AAACTTGGATTGCATTCAGTCACAG -3'
(R):5'- ACTTGGGTGCTCTTCCTGAAC -3'

Sequencing Primer
(F):5'- ATTGCATTCAGTCACAGTGAGG -3'
(R):5'- GAACTTTCTGATGCATGACCCCG -3'

Posted On

2019-12-20