Incidental Mutation 'R7861:Pramef6'
ID607495
Institutional Source Beutler Lab
Gene Symbol Pramef6
Ensembl Gene ENSMUSG00000078512
Gene NamePRAME family member 6
SynonymsGm13099
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7861 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143894237-143900380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143897718 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 70 (M70V)
Ref Sequence ENSEMBL: ENSMUSP00000101393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081645] [ENSMUST00000105767]
Predicted Effect probably benign
Transcript: ENSMUST00000081645
AA Change: M70V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080350
Gene: ENSMUSG00000078512
AA Change: M70V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 6e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105767
AA Change: M70V

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101393
Gene: ENSMUSG00000078512
AA Change: M70V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Pramef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Pramef6 APN 4 143895631 missense probably benign
IGL01917:Pramef6 APN 4 143897714 missense probably benign 0.15
IGL02222:Pramef6 APN 4 143895846 missense possibly damaging 0.94
IGL02315:Pramef6 APN 4 143897928 start gained probably benign
R0488:Pramef6 UTSW 4 143895403 missense probably benign 0.00
R0755:Pramef6 UTSW 4 143897729 missense probably damaging 0.96
R0972:Pramef6 UTSW 4 143896963 missense probably benign 0.02
R1444:Pramef6 UTSW 4 143896891 missense probably benign 0.01
R1551:Pramef6 UTSW 4 143895693 missense probably benign 0.00
R1907:Pramef6 UTSW 4 143895491 missense possibly damaging 0.89
R2068:Pramef6 UTSW 4 143896912 missense probably damaging 1.00
R2182:Pramef6 UTSW 4 143897190 missense possibly damaging 0.60
R2246:Pramef6 UTSW 4 143897220 missense probably benign 0.19
R4483:Pramef6 UTSW 4 143895840 missense probably damaging 1.00
R5123:Pramef6 UTSW 4 143897136 missense probably benign 0.00
R5291:Pramef6 UTSW 4 143895667 missense probably damaging 1.00
R5643:Pramef6 UTSW 4 143895767 missense probably damaging 0.98
R5683:Pramef6 UTSW 4 143895853 missense probably damaging 1.00
R5836:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5837:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5838:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5853:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R6340:Pramef6 UTSW 4 143897307 missense possibly damaging 0.69
R6572:Pramef6 UTSW 4 143895373 missense possibly damaging 0.79
R6791:Pramef6 UTSW 4 143895682 missense probably benign 0.02
R6972:Pramef6 UTSW 4 143896902 missense probably damaging 1.00
R7265:Pramef6 UTSW 4 143895421 missense probably benign 0.00
R7307:Pramef6 UTSW 4 143896775 nonsense probably null
R7342:Pramef6 UTSW 4 143896950 missense probably benign 0.26
R7361:Pramef6 UTSW 4 143895886 missense possibly damaging 0.88
R7480:Pramef6 UTSW 4 143895495 missense probably benign
R7685:Pramef6 UTSW 4 143897801 missense probably benign 0.28
R7944:Pramef6 UTSW 4 143897718 missense possibly damaging 0.75
Z1176:Pramef6 UTSW 4 143895684 missense probably damaging 1.00
Z1177:Pramef6 UTSW 4 143897199 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTCCATTCTAGAAGATACTGACCC -3'
(R):5'- ATGAGCTTCAAGGACCCACC -3'

Sequencing Primer
(F):5'- TAGAAGATACTGACCCCTATAAACAG -3'
(R):5'- CCAGCAGCTGGCAAGAAG -3'
Posted On2019-12-20