Incidental Mutation 'R7861:Zfyve28'
ID 607496
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Name zinc finger, FYVE domain containing 28
Synonyms 9630058O20Rik
MMRRC Submission 045914-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34352237-34445793 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34374487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 509 (L509Q)
Ref Sequence ENSEMBL: ENSMUSP00000092464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868]
AlphaFold Q6ZPK7
Predicted Effect probably damaging
Transcript: ENSMUST00000094868
AA Change: L509Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: L509Q

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,797,360 (GRCm39) I50F possibly damaging Het
Abcc3 T C 11: 94,248,075 (GRCm39) D1175G probably null Het
Accs C A 2: 93,666,077 (GRCm39) *503L probably null Het
Adgra2 A G 8: 27,604,485 (GRCm39) E520G probably damaging Het
Aldh7a1 C A 18: 56,681,525 (GRCm39) C215F probably benign Het
Apbb1ip A C 2: 22,706,990 (GRCm39) D9A unknown Het
Atad2 G A 15: 57,989,176 (GRCm39) A228V probably benign Het
Atp10a T C 7: 58,438,107 (GRCm39) S430P probably damaging Het
Atp1a3 T C 7: 24,700,573 (GRCm39) D6G unknown Het
Brca1 A T 11: 101,417,248 (GRCm39) N295K possibly damaging Het
Caly C A 7: 139,661,301 (GRCm39) probably benign Het
Ces1h A G 8: 94,084,053 (GRCm39) Y386H unknown Het
Col14a1 A G 15: 55,308,012 (GRCm39) D1044G unknown Het
Csf2rb A G 15: 78,233,357 (GRCm39) D888G probably damaging Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dhrs7b T A 11: 60,746,568 (GRCm39) L219Q probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnah14 C T 1: 181,444,324 (GRCm39) P545S probably damaging Het
Dnajc24 A T 2: 105,832,380 (GRCm39) M1K probably null Het
Dusp12 C T 1: 170,702,095 (GRCm39) W301* probably null Het
Dyrk1a G T 16: 94,492,575 (GRCm39) G603* probably null Het
Eif4g1 T A 16: 20,498,452 (GRCm39) V403E probably benign Het
Epn3 T C 11: 94,387,100 (GRCm39) E90G probably damaging Het
Etl4 A G 2: 20,810,721 (GRCm39) S1303G probably benign Het
Evpl A T 11: 116,118,895 (GRCm39) Y627N probably damaging Het
Fbxw25 A T 9: 109,493,625 (GRCm39) L22* probably null Het
Fcamr T A 1: 130,742,375 (GRCm39) N587K probably benign Het
Fgd6 A G 10: 93,939,193 (GRCm39) N946S probably benign Het
Fndc3b A T 3: 27,523,148 (GRCm39) I477N possibly damaging Het
Grifin C T 5: 140,550,280 (GRCm39) A54T probably benign Het
Gtf2b A G 3: 142,487,105 (GRCm39) I180M probably damaging Het
Invs A T 4: 48,397,559 (GRCm39) D378V possibly damaging Het
Itgb6 T C 2: 60,458,788 (GRCm39) E378G probably damaging Het
Khdc1a T C 1: 21,420,623 (GRCm39) I81T possibly damaging Het
Kif20b T A 19: 34,917,322 (GRCm39) D617E probably damaging Het
Kifc3 T A 8: 95,834,165 (GRCm39) probably null Het
Kirrel3 C T 9: 34,931,419 (GRCm39) H403Y possibly damaging Het
Klf15 G A 6: 90,443,820 (GRCm39) V132I probably benign Het
Kmt2a A G 9: 44,730,031 (GRCm39) S3429P unknown Het
Lama1 T G 17: 68,116,216 (GRCm39) L2361R Het
Lrp1b T C 2: 40,587,570 (GRCm39) D3895G Het
Mcoln3 A C 3: 145,830,546 (GRCm39) E92A possibly damaging Het
Myo3b T C 2: 69,939,032 (GRCm39) M135T probably damaging Het
Mysm1 A G 4: 94,835,204 (GRCm39) *820Q probably null Het
Ncoa7 A G 10: 30,567,056 (GRCm39) S541P probably benign Het
Nup54 T C 5: 92,578,952 (GRCm39) T33A unknown Het
Or10al2 C A 17: 37,983,408 (GRCm39) Q165K possibly damaging Het
Or13a17 T G 7: 140,271,484 (GRCm39) I222S probably damaging Het
Or1s2 T C 19: 13,758,810 (GRCm39) V276A possibly damaging Het
Or4k42 T A 2: 111,320,369 (GRCm39) I45F probably damaging Het
Or51a5 T A 7: 102,771,899 (GRCm39) I27F probably benign Het
Otud6b A G 4: 14,826,414 (GRCm39) C18R probably benign Het
Pde4d A G 13: 110,071,858 (GRCm39) E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pidd1 C A 7: 141,020,055 (GRCm39) W598L probably damaging Het
Pira2 A T 7: 3,847,543 (GRCm39) C49S probably damaging Het
Pramel11 T C 4: 143,624,288 (GRCm39) M70V possibly damaging Het
Prdx1 T G 4: 116,550,935 (GRCm39) D135E probably benign Het
Rab15 T A 12: 76,849,903 (GRCm39) Y88F probably damaging Het
Rem2 C A 14: 54,715,256 (GRCm39) H144Q probably damaging Het
Sel1l3 T C 5: 53,301,406 (GRCm39) D737G probably damaging Het
Srd5a3 C T 5: 76,295,666 (GRCm39) Q119* probably null Het
Suclg2 G T 6: 95,571,703 (GRCm39) Q120K probably benign Het
Tacc2 T A 7: 130,227,161 (GRCm39) M1282K probably benign Het
Tbc1d5 T A 17: 51,063,720 (GRCm39) Q620L probably damaging Het
Tdrd3 G T 14: 87,709,590 (GRCm39) A91S probably damaging Het
Thsd7b T A 1: 130,087,435 (GRCm39) F1184Y probably benign Het
Trim28 T A 7: 12,762,339 (GRCm39) V321E possibly damaging Het
Trim5 C A 7: 103,915,675 (GRCm39) probably null Het
Ugt2b37 A T 5: 87,390,299 (GRCm39) Y382* probably null Het
Usp40 C T 1: 87,909,852 (GRCm39) G534D probably damaging Het
Usp53 A T 3: 122,728,112 (GRCm39) H823Q probably benign Het
Vmn2r12 T A 5: 109,235,829 (GRCm39) M508L probably benign Het
Vmn2r56 T A 7: 12,449,351 (GRCm39) I296F probably benign Het
Vps13a T C 19: 16,632,668 (GRCm39) S2563G probably damaging Het
Wdr59 A G 8: 112,220,912 (GRCm39) F207L Het
Zan A G 5: 137,405,295 (GRCm39) S3777P unknown Het
Zfp277 T C 12: 40,365,880 (GRCm39) N530D possibly damaging Het
Zfp365 G A 10: 67,745,749 (GRCm39) R10W probably damaging Het
Zfp384 A T 6: 125,013,288 (GRCm39) H452L probably damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34,400,539 (GRCm39) missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34,400,549 (GRCm39) missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34,390,721 (GRCm39) missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34,389,550 (GRCm39) missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34,374,408 (GRCm39) missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34,356,145 (GRCm39) missense probably benign 0.00
R1351:Zfyve28 UTSW 5 34,389,549 (GRCm39) missense probably damaging 1.00
R1418:Zfyve28 UTSW 5 34,374,590 (GRCm39) missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34,391,681 (GRCm39) missense probably null 0.73
R2212:Zfyve28 UTSW 5 34,357,028 (GRCm39) missense probably benign 0.02
R2443:Zfyve28 UTSW 5 34,374,238 (GRCm39) missense possibly damaging 0.64
R2851:Zfyve28 UTSW 5 34,354,006 (GRCm39) missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34,354,006 (GRCm39) missense probably damaging 1.00
R3412:Zfyve28 UTSW 5 34,357,028 (GRCm39) missense probably benign 0.02
R3413:Zfyve28 UTSW 5 34,357,028 (GRCm39) missense probably benign 0.02
R3694:Zfyve28 UTSW 5 34,374,812 (GRCm39) missense probably damaging 1.00
R4645:Zfyve28 UTSW 5 34,379,787 (GRCm39) intron probably benign
R4700:Zfyve28 UTSW 5 34,375,189 (GRCm39) missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34,390,698 (GRCm39) missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34,374,311 (GRCm39) missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34,374,214 (GRCm39) missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34,382,332 (GRCm39) missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34,356,216 (GRCm39) missense probably damaging 0.99
R6862:Zfyve28 UTSW 5 34,445,449 (GRCm39) missense probably benign 0.10
R7172:Zfyve28 UTSW 5 34,391,753 (GRCm39) missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34,356,219 (GRCm39) missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34,389,571 (GRCm39) missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34,393,461 (GRCm39) missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34,400,539 (GRCm39) missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34,382,326 (GRCm39) missense probably damaging 1.00
R7878:Zfyve28 UTSW 5 34,356,999 (GRCm39) missense probably damaging 1.00
R7901:Zfyve28 UTSW 5 34,382,326 (GRCm39) missense probably damaging 1.00
R8116:Zfyve28 UTSW 5 34,374,944 (GRCm39) missense probably damaging 0.96
R8483:Zfyve28 UTSW 5 34,393,480 (GRCm39) missense possibly damaging 0.67
R8799:Zfyve28 UTSW 5 34,390,670 (GRCm39) missense probably damaging 1.00
R8883:Zfyve28 UTSW 5 34,375,211 (GRCm39) critical splice acceptor site probably null
R8912:Zfyve28 UTSW 5 34,374,655 (GRCm39) missense probably benign 0.01
R9179:Zfyve28 UTSW 5 34,382,376 (GRCm39) missense probably benign 0.01
R9228:Zfyve28 UTSW 5 34,374,788 (GRCm39) missense probably benign
R9381:Zfyve28 UTSW 5 34,373,932 (GRCm39) missense probably benign 0.09
R9432:Zfyve28 UTSW 5 34,400,633 (GRCm39) missense possibly damaging 0.92
R9509:Zfyve28 UTSW 5 34,354,892 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACTGATGACACTTCCTGGGC -3'
(R):5'- TAATGCCCAGCAGAGAGGAC -3'

Sequencing Primer
(F):5'- TGACACTTCCTGGGCCACAC -3'
(R):5'- GCACCTGCCCTGGTAAAG -3'
Posted On 2019-12-20