Mutagenetix > Incidental Mutation

Incidental Mutation 'R0196:Pikfyve'

60750

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

038455-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0196 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 65295231 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1454 (V1454G)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: V1454G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: V1454G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707
AA Change: V1499G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: V1499G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,446,591 (GRCm39)		probably benign	Het
Aass	G	A	6: 23,109,519 (GRCm39)	P317L	probably damaging	Het
Abca12	T	A	1: 71,298,972 (GRCm39)	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,594 (GRCm39)	I46T	probably benign	Het
Adipoq	T	G	16: 22,965,393 (GRCm39)		probably null	Het
Amy1	A	T	3: 113,363,070 (GRCm39)	D92E	probably benign	Het
Asb15	G	A	6: 24,564,392 (GRCm39)	R282Q	probably damaging	Het
Bag6	G	C	17: 35,363,239 (GRCm39)	G693A	probably damaging	Het
Birc6	T	C	17: 74,887,282 (GRCm39)	I870T	possibly damaging	Het
Cand2	A	G	6: 115,766,463 (GRCm39)	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 123,360,076 (GRCm39)	Q525R	possibly damaging	Het
Cd4	T	C	6: 124,844,769 (GRCm39)	R339G	probably damaging	Het
Cdh8	A	G	8: 99,917,066 (GRCm39)	S350P	probably damaging	Het
Cep295	A	T	9: 15,249,509 (GRCm39)	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,127,342 (GRCm39)	S279T	probably benign	Het
Clnk	T	A	5: 38,927,282 (GRCm39)	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,142,503 (GRCm39)	T64S	probably benign	Het
Crtc1	T	C	8: 70,838,871 (GRCm39)	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,000,795 (GRCm39)	I363S	probably damaging	Het
Dnah10	A	T	5: 124,911,139 (GRCm39)	I4519F	possibly damaging	Het
Dner	T	A	1: 84,348,553 (GRCm39)	I716F	probably damaging	Het
Dsel	T	G	1: 111,789,333 (GRCm39)	T401P	possibly damaging	Het
Egfr	A	G	11: 16,861,746 (GRCm39)	D1175G	probably benign	Het
Ephb3	A	T	16: 21,036,804 (GRCm39)	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,768,070 (GRCm39)	F974I	probably benign	Het
Gfi1b	T	C	2: 28,503,786 (GRCm39)	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175 (GRCm39)	L6H	probably benign	Het
Grb10	A	C	11: 11,895,583 (GRCm39)	V247G	probably damaging	Het
Gstp2	A	T	19: 4,090,514 (GRCm39)		probably null	Het
Hars2	C	T	18: 36,922,257 (GRCm39)	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,220 (GRCm39)	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,461,556 (GRCm39)	T107I	possibly damaging	Het
Itga8	A	G	2: 12,209,540 (GRCm39)		probably null	Het
Klhl25	T	C	7: 75,515,450 (GRCm39)	S119P	probably damaging	Het
Krt81	C	A	15: 101,361,508 (GRCm39)	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,754,636 (GRCm39)	V137A	probably benign	Het
Macrod2	A	T	2: 142,018,545 (GRCm39)	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,718,201 (GRCm39)	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,265,453 (GRCm39)	K82M	probably benign	Het
Mpzl3	A	G	9: 44,973,458 (GRCm39)	T66A	probably damaging	Het
Msh6	G	A	17: 88,287,788 (GRCm39)	V143I	possibly damaging	Het
Mug1	G	A	6: 121,815,684 (GRCm39)		probably null	Het
Ncr1	G	T	7: 4,343,972 (GRCm39)	C153F	probably damaging	Het
Nf1	T	A	11: 79,359,595 (GRCm39)	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,469,098 (GRCm39)	V786D	probably damaging	Het
Nisch	T	C	14: 30,925,351 (GRCm39)		probably benign	Het
Nwd2	T	A	5: 63,963,694 (GRCm39)	Y1093N	probably benign	Het
Oas3	G	A	5: 120,894,210 (GRCm39)	R39C	probably damaging	Het
Or1e32	A	T	11: 73,705,731 (GRCm39)	M59K	probably damaging	Het
Or7a36	C	T	10: 78,820,023 (GRCm39)	T133I	possibly damaging	Het
Oxa1l	T	C	14: 54,600,944 (GRCm39)	I139T	probably damaging	Het
P3h3	T	A	6: 124,822,235 (GRCm39)	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,711,147 (GRCm39)		probably null	Het
Pcnp	C	T	16: 55,844,896 (GRCm39)		probably benign	Het
Pdzd8	G	T	19: 59,289,563 (GRCm39)	D612E	probably benign	Het
Pi4kb	T	C	3: 94,906,261 (GRCm39)	S8P	probably damaging	Het
Podn	T	C	4: 107,878,695 (GRCm39)	N246D	probably damaging	Het
Prg4	T	C	1: 150,330,243 (GRCm39)		probably benign	Het
R3hdm2	T	C	10: 127,320,390 (GRCm39)	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,213,904 (GRCm39)	E231V	possibly damaging	Het
Slc16a10	C	T	10: 39,932,611 (GRCm39)	E317K	probably benign	Het
Slc34a1	A	T	13: 55,560,078 (GRCm39)	I435F	probably damaging	Het
Snx19	A	G	9: 30,344,683 (GRCm39)	D629G	probably damaging	Het
Tomm70a	T	C	16: 56,966,463 (GRCm39)	I472T	probably benign	Het
Trp53	A	G	11: 69,479,506 (GRCm39)	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,863,403 (GRCm39)		probably benign	Het
Ugt1a1	C	T	1: 88,140,277 (GRCm39)	A185V	possibly damaging	Het
Usp28	A	G	9: 48,939,578 (GRCm39)	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,260,254 (GRCm39)	T98I	probably damaging	Het
Vmn2r121	G	T	X: 123,041,879 (GRCm39)	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,614,835 (GRCm39)	N852D	probably benign	Het
Xrn2	T	A	2: 146,889,580 (GRCm39)	D654E	probably damaging	Het
Yju2	C	A	17: 56,271,653 (GRCm39)	D191E	probably damaging	Het
Zfp335	C	G	2: 164,738,065 (GRCm39)	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,118,390 (GRCm39)	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,355,052 (GRCm39)	T350A	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACTTGTTTCTGTTGCTTTCCAGATGG -3'
(R):5'- ATGATTCACAGTCTCAGTAGCACACAC -3'

Sequencing Primer
(F):5'- TGCTTTCCAGATGGAAGAGG -3'
(R):5'- ACAGCAATGAGGGCTATTTCC -3'

Posted On

2013-07-24