Incidental Mutation 'R7861:Nup54'
ID607500
Institutional Source Beutler Lab
Gene Symbol Nup54
Ensembl Gene ENSMUSG00000034826
Gene Namenucleoporin 54
Synonyms54kDa, 3110079L04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7861 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92415540-92435219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92431093 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000046540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038514] [ENSMUST00000135112] [ENSMUST00000146470]
Predicted Effect unknown
Transcript: ENSMUST00000038514
AA Change: T33A
SMART Domains Protein: ENSMUSP00000046540
Gene: ENSMUSG00000034826
AA Change: T33A

DomainStartEndE-ValueType
low complexity region 5 109 N/A INTRINSIC
Pfam:Nup54 303 441 4.8e-49 PFAM
PDB:3T98|C 445 494 2e-26 PDB
Predicted Effect unknown
Transcript: ENSMUST00000130156
AA Change: T99A
SMART Domains Protein: ENSMUSP00000120937
Gene: ENSMUSG00000034826
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 82 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135112
AA Change: T87A
SMART Domains Protein: ENSMUSP00000117237
Gene: ENSMUSG00000034826
AA Change: T87A

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
internal_repeat_1 34 53 3.34e-6 PROSPERO
internal_repeat_1 49 68 3.34e-6 PROSPERO
low complexity region 69 97 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000146470
SMART Domains Protein: ENSMUSP00000121171
Gene: ENSMUSG00000034826

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 46 66 N/A INTRINSIC
low complexity region 75 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the phe-gly (FG) repeat-containing nucleoporin subset. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Nup54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Nup54 APN 5 92417485 missense probably benign 0.00
IGL01526:Nup54 APN 5 92417475 missense probably benign 0.12
IGL01924:Nup54 APN 5 92424435 missense probably benign 0.02
IGL02248:Nup54 APN 5 92428329 splice site probably null
IGL02253:Nup54 APN 5 92417451 critical splice donor site probably null
IGL02508:Nup54 APN 5 92417539 nonsense probably null
IGL02721:Nup54 APN 5 92417857 missense possibly damaging 0.96
IGL03150:Nup54 APN 5 92428164 missense probably damaging 1.00
R0189:Nup54 UTSW 5 92422564 missense probably damaging 1.00
R1401:Nup54 UTSW 5 92428221 missense probably damaging 1.00
R1862:Nup54 UTSW 5 92419567 missense possibly damaging 0.75
R3938:Nup54 UTSW 5 92417529 missense probably damaging 1.00
R4171:Nup54 UTSW 5 92417484 missense possibly damaging 0.64
R4574:Nup54 UTSW 5 92425782 missense probably benign 0.17
R5372:Nup54 UTSW 5 92417857 missense probably damaging 1.00
R6003:Nup54 UTSW 5 92422994 missense probably damaging 1.00
R6191:Nup54 UTSW 5 92424294 missense probably damaging 0.99
R6197:Nup54 UTSW 5 92430804 utr 3 prime probably benign
R7944:Nup54 UTSW 5 92431093 missense unknown
R8005:Nup54 UTSW 5 92428147 missense probably benign 0.00
R8016:Nup54 UTSW 5 92434317 missense unknown
Z1177:Nup54 UTSW 5 92434279 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTGTTCTGAGTGCCACCG -3'
(R):5'- ACGTTACCCATTTAGTTAACGGG -3'

Sequencing Primer
(F):5'- TGTTCTGAGTGCCACCGAGAAG -3'
(R):5'- GCAATGCATTGACCTTCTGATTAG -3'
Posted On2019-12-20