Mutagenetix > Incidental Mutation

Incidental Mutation 'R0196:Itga8'

60752

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

038455-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R0196 (G1)

Quality Score

118

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 12204729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably null
Transcript: ENSMUST00000028106

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCCACCTAAAACATGAGTCATTTTCCG -3'
(R):5'- TGCATGAAACAAGGTTGTCTGGTATGG -3'

Sequencing Primer
(F):5'- GAGCTAGAGGTTTGCTCATAAAG -3'
(R):5'- TTCTGATCTGGGCTTTCAGG -3'

Posted On

2013-07-24