Mutagenetix > Incidental Mutations

Incidental Mutation 'R7861:Pidd1'

607520

Institutional Source

Beutler Lab

Gene Symbol

Pidd1

Ensembl Gene

ENSMUSG00000025507

Gene Name

p53 induced death domain protein 1

Synonyms

1200011D09Rik, Lrdd, Pidd

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141438113-141444025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 141440142 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 598 (W598L)

Ref Sequence

ENSEMBL: ENSMUSP00000101627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000138865] [ENSMUST00000172654] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000201710] [ENSMUST00000201822]

Predicted Effect

probably benign
Transcript: ENSMUST00000019226

SMART Domains

Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	98	8.1e-26	PFAM
Pfam:Mito_carr	99	217	8.6e-19	PFAM
Pfam:Mito_carr	221	310	7.4e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000026580
AA Change: W598L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: W598L

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
LRR	129	150	1.66e1	SMART
LRR	152	174	9.48e0	SMART
LRR	175	197	1.81e1	SMART
LRR	198	220	5.56e0	SMART
LRR	221	243	8.67e-1	SMART
LRR	244	266	7.57e0	SMART
LRR	267	290	6.13e-1	SMART
low complexity region	303	311	N/A	INTRINSIC
low complexity region	406	419	N/A	INTRINSIC
Pfam:Peptidase_S68	426	459	3.5e-26	PFAM
Pfam:ZU5	463	551	5e-9	PFAM
low complexity region	563	574	N/A	INTRINSIC
low complexity region	734	744	N/A	INTRINSIC
DEATH	783	878	8.31e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106005
AA Change: W598L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: W598L

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
LRR	129	150	1.66e1	SMART
LRR	152	174	9.48e0	SMART
LRR	175	197	1.81e1	SMART
LRR	198	220	5.56e0	SMART
LRR	221	243	8.67e-1	SMART
LRR	244	266	7.57e0	SMART
LRR	267	290	6.13e-1	SMART
low complexity region	303	311	N/A	INTRINSIC
Pfam:ZU5	328	422	6.6e-11	PFAM
Pfam:Peptidase_S68	426	458	5.2e-21	PFAM
Pfam:ZU5	463	546	6.5e-9	PFAM
low complexity region	563	574	N/A	INTRINSIC
low complexity region	734	744	N/A	INTRINSIC
DEATH	783	878	8.31e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106006

SMART Domains

Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	98	2.8e-26	PFAM
Pfam:Mito_carr	99	137	5.6e-8	PFAM
Pfam:Mito_carr	134	216	2.5e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124266

SMART Domains

Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	98	2.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128703

SMART Domains

Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
LRR	129	148	3.5e-1	SMART
LRR	152	171	1.4e-1	SMART
LRR	175	194	3.9e-2	SMART
LRR	198	217	8.7e-1	SMART
LRR	221	240	9.6e-2	SMART
LRR	244	266	3.1e-2	SMART
LRR	267	286	1.3e-1	SMART
low complexity region	303	311	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138865

SMART Domains

Protein: ENSMUSP00000120721
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	98	1.4e-25	PFAM
Pfam:Mito_carr	99	214	1.8e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172654

SMART Domains

Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	54	6.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190068

SMART Domains

Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
LRR	129	148	3.5e-1	SMART
LRR	152	171	1.4e-1	SMART
LRR	175	194	3.9e-2	SMART
LRR	198	217	8.7e-1	SMART
LRR	221	240	9.6e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190882

SMART Domains

Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

Domain	Start	End	E-Value	Type
low complexity region	9	27	N/A	INTRINSIC
LRR	129	148	3.5e-1	SMART
LRR	152	171	1.4e-1	SMART
LRR	175	194	3.9e-2	SMART
LRR	198	217	8.7e-1	SMART
LRR_TYP	221	244	3.7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201710

SMART Domains

Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	98	1.7e-26	PFAM
Pfam:Mito_carr	99	217	2.3e-18	PFAM
Pfam:Mito_carr	221	311	5.7e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201822

SMART Domains

Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	4	70	1.2e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Brca1	A	T	11: 101,526,422	N295K	possibly damaging	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Etl4	A	G	2: 20,805,910	S1303G	probably benign	Het
Evpl	A	T	11: 116,228,069	Y627N	probably damaging	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Invs	A	T	4: 48,397,559	D378V	possibly damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kifc3	T	A	8: 95,107,537		probably null	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Pidd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02751:Pidd1	APN	7	141439163	missense	possibly damaging	0.93
IGL02794:Pidd1	APN	7	141443108	missense	probably benign	0.00
IGL03083:Pidd1	APN	7	141440456	critical splice donor site	probably null
IGL03347:Pidd1	APN	7	141439168	missense	probably damaging	0.97
R0329:Pidd1	UTSW	7	141439561	unclassified	probably benign
R0426:Pidd1	UTSW	7	141439133	missense	probably damaging	1.00
R0650:Pidd1	UTSW	7	141440813	nonsense	probably null
R0651:Pidd1	UTSW	7	141440813	nonsense	probably null
R1201:Pidd1	UTSW	7	141440274	missense	probably benign
R1221:Pidd1	UTSW	7	141438812	missense	probably damaging	1.00
R1613:Pidd1	UTSW	7	141440777	missense	probably damaging	1.00
R1763:Pidd1	UTSW	7	141439630	missense	probably benign
R3967:Pidd1	UTSW	7	141439082	missense	possibly damaging	0.86
R4072:Pidd1	UTSW	7	141440826	missense	probably damaging	1.00
R4073:Pidd1	UTSW	7	141440826	missense	probably damaging	1.00
R4075:Pidd1	UTSW	7	141440826	missense	probably damaging	1.00
R4076:Pidd1	UTSW	7	141440826	missense	probably damaging	1.00
R4157:Pidd1	UTSW	7	141441366	missense	possibly damaging	0.87
R4501:Pidd1	UTSW	7	141441443	unclassified	probably benign
R4700:Pidd1	UTSW	7	141442249	missense	probably damaging	1.00
R4797:Pidd1	UTSW	7	141442986	missense	possibly damaging	0.92
R4985:Pidd1	UTSW	7	141438591	makesense	probably null
R5402:Pidd1	UTSW	7	141438594	missense	probably damaging	1.00
R5684:Pidd1	UTSW	7	141441111	splice site	probably null
R5790:Pidd1	UTSW	7	141441392	unclassified	probably benign
R5909:Pidd1	UTSW	7	141441270	missense	probably damaging	1.00
R6275:Pidd1	UTSW	7	141439795	missense	probably damaging	1.00
R6582:Pidd1	UTSW	7	141439581	missense	probably damaging	1.00
R6814:Pidd1	UTSW	7	141439418	missense	probably benign	0.34
R6872:Pidd1	UTSW	7	141439418	missense	probably benign	0.34
R6935:Pidd1	UTSW	7	141440302	missense	probably damaging	1.00
R7088:Pidd1	UTSW	7	141440487	missense	probably damaging	1.00
R7133:Pidd1	UTSW	7	141439900	missense	probably benign	0.05
R7544:Pidd1	UTSW	7	141440339	missense	possibly damaging	0.81
R7821:Pidd1	UTSW	7	141442280	missense	probably benign	0.36
R7903:Pidd1	UTSW	7	141439831	missense	probably damaging	0.99
R7944:Pidd1	UTSW	7	141440142	missense	probably damaging	1.00
R7986:Pidd1	UTSW	7	141439831	missense	probably damaging	0.99
Z1176:Pidd1	UTSW	7	141440361	missense	probably benign	0.03
Z1177:Pidd1	UTSW	7	141438696	missense	probably damaging	1.00
Z1177:Pidd1	UTSW	7	141441016	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAAAGCTTTGTACCCAGC -3'
(R):5'- TGCATCTGCTCTACCGAAC -3'

Sequencing Primer
(F):5'- AGCTTTGTACCCAGCCTGGC -3'
(R):5'- TGCTCTACCGAACACCCCTG -3'

Posted On

2019-12-20